Transcript: Human XM_006725534.2

PREDICTED: Homo sapiens keratin associated protein 5-5 (KRTAP5-5), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KRTAP5-5 (439915)
Length:
1115
CDS:
74..739

Additional Resources:

NCBI RefSeq record:
XM_006725534.2
NBCI Gene record:
KRTAP5-5 (439915)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006725534.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254754 CTCCCTGCTCCTCACTCATTT pLKO_005 931 3UTR 100% 13.200 9.240 N KRTAP5-5 n/a
2 TRCN0000254750 TCCAGCTGCTGTAAGCCTTAC pLKO_005 581 CDS 100% 6.000 3.600 N KRTAP5-5 n/a
3 TRCN0000254752 TGGATCATCCTGCTGCCAATC pLKO_005 649 CDS 100% 6.000 3.600 N KRTAP5-5 n/a
4 TRCN0000254753 TGTAAGCCCTGTAGCTGCTTC pLKO_005 620 CDS 100% 4.050 2.430 N KRTAP5-5 n/a
5 TRCN0000254457 CGTGTGCTGCCAGTGTAAGAT pLKO_005 715 CDS 100% 5.625 2.813 Y KRTAP5-11 n/a
6 TRCN0000254751 TGCCAGTCCAGCTGCTGTAAG pLKO_005 575 CDS 100% 3.600 1.800 Y KRTAP5-5 n/a
7 TRCN0000254434 GCTGCTGTGTGCCAGCTTGTT pLKO_005 303 CDS 100% 1.650 0.825 Y KRTAP5-1 n/a
8 TRCN0000254438 TCTGCTGCTGCAAGCCCATGT pLKO_005 282 CDS 100% 1.350 0.675 Y KRTAP5-1 n/a
9 TRCN0000254456 TCCTCAGGCTGTGGGTCATTC pLKO_005 551 CDS 100% 3.600 1.800 Y KRTAP5-11 n/a
10 TRCN0000098413 GCTGCTGTGTGCCTGTCTGTT pLKO.1 267 CDS 100% 1.650 0.825 Y Krtap5-4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006725534.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00915 pDONR223 100% 57% 54.5% None (many diffs) n/a
2 ccsbBroad304_00915 pLX_304 0% 57% 54.5% V5 (many diffs) n/a
3 TRCN0000473555 AATCGCAAATACTACCTAGATCGT pLX_317 94.8% 57% 54.5% V5 (many diffs) n/a
4 ccsbBroadEn_05666 pDONR223 100% 53.3% 53.8% None (many diffs) n/a
5 ccsbBroad304_05666 pLX_304 0% 53.3% 53.8% V5 (many diffs) n/a
6 TRCN0000475440 ACCAAGCTTTGGTAAGATGTTTGA pLX_317 10.7% 53.3% 53.8% V5 (many diffs) n/a
Download CSV