Transcript: Mouse XM_011239045.2

PREDICTED: Mus musculus spermatid perinuclear RNA binding protein (Strbp), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Strbp (20744)
Length:
5551
CDS:
469..2505

Additional Resources:

NCBI RefSeq record:
XM_011239045.2
NBCI Gene record:
Strbp (20744)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011239045.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000017718 CGCCATGTTATGGTGAAACAT pLKO.1 502 CDS 100% 0.563 0.788 N STRBP n/a
2 TRCN0000086391 CCCTCTAATTAGGGACGAATT pLKO.1 966 CDS 100% 0.000 0.000 N Strbp n/a
3 TRCN0000315987 CCCTCTAATTAGGGACGAATT pLKO_005 966 CDS 100% 0.000 0.000 N Strbp n/a
4 TRCN0000017719 CGCTTTGTAATGGAGGTAGAA pLKO.1 2086 CDS 100% 4.950 3.960 N STRBP n/a
5 TRCN0000086392 GCACTTAGACTATCAGCCTTT pLKO.1 1405 CDS 100% 4.050 3.240 N Strbp n/a
6 TRCN0000315985 GCACTTAGACTATCAGCCTTT pLKO_005 1405 CDS 100% 4.050 3.240 N Strbp n/a
7 TRCN0000086390 CCTATTCAGATTCAGAAACTA pLKO.1 844 CDS 100% 5.625 3.938 N Strbp n/a
8 TRCN0000315986 CCTATTCAGATTCAGAAACTA pLKO_005 844 CDS 100% 5.625 3.938 N Strbp n/a
9 TRCN0000086389 GCTTGCTGATTAAAGATGATA pLKO.1 749 CDS 100% 5.625 3.938 N Strbp n/a
10 TRCN0000315912 GCTTGCTGATTAAAGATGATA pLKO_005 749 CDS 100% 5.625 3.938 N Strbp n/a
11 TRCN0000192214 CTTATTTCATGCTGGGACATT pLKO.1 5333 3UTR 100% 4.950 3.465 N Strbp n/a
12 TRCN0000086388 GCTGAGATATAGTGACTGTAA pLKO.1 2606 3UTR 100% 4.950 2.970 N Strbp n/a
13 TRCN0000315988 GCTGAGATATAGTGACTGTAA pLKO_005 2606 3UTR 100% 4.950 2.970 N Strbp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011239045.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08525 pDONR223 100% 90.3% 91.9% None (many diffs) n/a
2 ccsbBroad304_08525 pLX_304 0% 90.3% 91.9% V5 (many diffs) n/a
3 TRCN0000473208 ACGCAAGCATAACAGAGCTCCCTT pLX_317 20.2% 90.3% 91.9% V5 (many diffs) n/a
Download CSV