Transcript: Mouse XM_011239260.2

PREDICTED: Mus musculus BCL2-like 1 (Bcl2l1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Bcl2l1 (12048)
Length:
2308
CDS:
130..831

Additional Resources:

NCBI RefSeq record:
XM_011239260.2
NBCI Gene record:
Bcl2l1 (12048)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011239260.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000004683 GTGGATCTCTACGGGAACAAT pLKO.1 703 CDS 100% 5.625 7.875 N Bcl2l1 n/a
2 TRCN0000278147 GTGGATCTCTACGGGAACAAT pLKO_005 703 CDS 100% 5.625 7.875 N Bcl2l1 n/a
3 TRCN0000004684 CAGGTATTGGTGAGTCGGATT pLKO.1 607 CDS 100% 4.050 5.670 N Bcl2l1 n/a
4 TRCN0000297134 CAGGTATTGGTGAGTCGGATT pLKO_005 607 CDS 100% 4.050 5.670 N Bcl2l1 n/a
5 TRCN0000004685 AGCTGGAGTCAGTTTAGTGAT pLKO.1 196 CDS 100% 4.950 3.465 N Bcl2l1 n/a
6 TRCN0000278077 AGCTGGAGTCAGTTTAGTGAT pLKO_005 196 CDS 100% 4.950 3.465 N Bcl2l1 n/a
7 TRCN0000004682 CAGGAGAACCACTACATGCAA pLKO.1 910 3UTR 100% 3.000 2.100 N Bcl2l1 n/a
8 TRCN0000278076 CAGGAGAACCACTACATGCAA pLKO_005 910 3UTR 100% 3.000 2.100 N Bcl2l1 n/a
9 TRCN0000010905 CGATGAGTTTGAACTGCGGTA pLKO.1 411 CDS 100% 2.160 1.512 N Bcl2l1 n/a
10 TRCN0000278078 CGATGAGTTTGAACTGCGGTA pLKO_005 411 CDS 100% 2.160 1.512 N Bcl2l1 n/a
11 TRCN0000033499 GCTCACTCTTCAGTCGGAAAT pLKO.1 809 CDS 100% 10.800 7.560 N BCL2L1 n/a
12 TRCN0000299585 GCTCACTCTTCAGTCGGAAAT pLKO_005 809 CDS 100% 10.800 7.560 N BCL2L1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011239260.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00156 pDONR223 100% 93.5% 97.8% None (many diffs) n/a
2 ccsbBroad304_00156 pLX_304 87.4% 93.5% 97.8% V5 (many diffs) n/a
3 TRCN0000472603 CGCGCAGAGAGTGGTAGCATGAGA pLX_317 74.2% 93.5% 97.8% V5 (many diffs) n/a
4 TRCN0000489920 TATGCTACCACAGAGAAAGCAATC pLX_317 70% 93.5% 97.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV