Transcript: Mouse XM_011239271.2

PREDICTED: Mus musculus cholinergic receptor, muscarinic 4 (Chrm4), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Chrm4 (12672)
Length:
3266
CDS:
206..2119

Additional Resources:

NCBI RefSeq record:
XM_011239271.2
NBCI Gene record:
Chrm4 (12672)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011239271.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419541 ATCATGACGGTGCTGTATATT pLKO_005 1304 CDS 100% 15.000 10.500 N Chrm4 n/a
2 TRCN0000414310 TCTGATGAAGCCGAGCATTAA pLKO_005 1420 CDS 100% 13.200 9.240 N Chrm4 n/a
3 TRCN0000367729 CCATCTTGTTCTGGCAGTTTG pLKO_005 1176 CDS 100% 10.800 7.560 N CHRM4 n/a
4 TRCN0000026322 CCAAGATCCAAATTGTGACAA pLKO.1 1698 CDS 100% 4.950 3.465 N Chrm4 n/a
5 TRCN0000026242 CCAGTGCTTCATCCAGTTCTT pLKO.1 1225 CDS 100% 4.950 3.465 N Chrm4 n/a
6 TRCN0000026262 CTGGACTATGTGGTGAGCAAT pLKO.1 1007 CDS 100% 4.950 3.465 N Chrm4 n/a
7 TRCN0000026289 GCAGTTGCAGACAGTCAACAA pLKO.1 859 CDS 100% 4.950 3.465 N Chrm4 n/a
8 TRCN0000026300 GCTGACAAGGACACTTCCAAT pLKO.1 1538 CDS 100% 4.950 3.465 N Chrm4 n/a
9 TRCN0000011264 GCCATCTTGTTCTGGCAGTTT pLKO.1 1175 CDS 100% 4.950 2.970 N CHRM4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011239271.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00306 pDONR223 100% 67.2% 72.1% None (many diffs) n/a
2 ccsbBroad304_00306 pLX_304 0% 67.2% 72.1% V5 (many diffs) n/a
3 TRCN0000476559 CTCTCTAGGCTCAGGCAAATTATA pLX_317 25% 67.2% 72.1% V5 (many diffs) n/a
4 TRCN0000488527 GTCATGATTAGTTTTATACGATGT pLX_317 23.5% 67.2% 72.1% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000491288 TAGGGCGCTACTTAGAGATGACAG pLX_317 23.4% 67.1% 71.9% V5 (many diffs) n/a
Download CSV