Transcript: Mouse XM_011239456.2

PREDICTED: Mus musculus RIKEN cDNA 1110051M20 gene (1110051M20Rik), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
1110051M20Rik (228356)
Length:
1623
CDS:
157..1083

Additional Resources:

NCBI RefSeq record:
XM_011239456.2
NBCI Gene record:
1110051M20Rik (228356)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011239456.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000198312 GAGGCTGACTTTCTATGGATT pLKO.1 780 CDS 100% 4.950 3.465 N 1110051M20Rik n/a
2 TRCN0000178121 GCTGACATACATCACAGAGAA pLKO.1 1280 3UTR 100% 4.950 3.465 N 1110051M20Rik n/a
3 TRCN0000181302 CGCTTGTCAAAGAGATCCTGA pLKO.1 749 CDS 100% 2.640 1.848 N 1110051M20Rik n/a
4 TRCN0000198264 GCTGAAGAGAAGGGTGAATTA pLKO.1 1176 3UTR 100% 13.200 7.920 N 1110051M20Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011239456.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04050 pDONR223 100% 80% 85.1% None (many diffs) n/a
2 ccsbBroad304_04050 pLX_304 0% 80% 85.1% V5 (many diffs) n/a
3 TRCN0000472324 TATATATCTGTACCCCTTAACACC pLX_317 42.2% 80% 85.1% V5 (many diffs) n/a
4 ccsbBroadEn_04049 pDONR223 100% 66.4% 71.9% None (many diffs) n/a
5 ccsbBroad304_04049 pLX_304 0% 66.4% 71.9% V5 (many diffs) n/a
6 TRCN0000477445 GCCAGTACTACACCTGCAGCGAAG pLX_317 57.3% 66.4% 71.9% V5 (many diffs) n/a
Download CSV