Transcript: Mouse XM_011239534.2

PREDICTED: Mus musculus double zinc ribbon and ankyrin repeat domains 1 (Dzank1), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dzank1 (241688)
Length:
6778
CDS:
157..2409

Additional Resources:

NCBI RefSeq record:
XM_011239534.2
NBCI Gene record:
Dzank1 (241688)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011239534.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000121425 GTCCATAACAAGGTTTAGAAT pLKO.1 1263 CDS 100% 5.625 7.875 N Dzank1 n/a
2 TRCN0000121424 CCCATATTTGGCTATCGTCTT pLKO.1 919 CDS 100% 4.050 5.670 N Dzank1 n/a
3 TRCN0000121423 GCCACTTTACTGGGATGCAAT pLKO.1 2230 CDS 100% 4.950 3.465 N Dzank1 n/a
4 TRCN0000121426 GCTGTTGTGAATAAACACTAT pLKO.1 2092 CDS 100% 4.950 3.465 N Dzank1 n/a
5 TRCN0000121422 CCTCCGAAGTAGCTGAGATTA pLKO.1 2838 3UTR 100% 13.200 7.920 N Dzank1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011239534.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12179 pDONR223 100% 28.8% 18.6% None (many diffs) n/a
2 ccsbBroad304_12179 pLX_304 0% 28.8% 18.6% V5 (many diffs) n/a
3 TRCN0000474121 GAACTTTATTTTACAAACTGTAGT pLX_317 69.2% 28.8% 18.6% V5 (many diffs) n/a
Download CSV