Transcript: Mouse XM_011239584.2

PREDICTED: Mus musculus transformation related protein 53 binding protein 1 (Trp53bp1), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Trp53bp1 (27223)
Length:
9617
CDS:
273..6032

Additional Resources:

NCBI RefSeq record:
XM_011239584.2
NBCI Gene record:
Trp53bp1 (27223)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011239584.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000321526 GATGCGAGCACTGCAATTAAA pLKO_005 912 CDS 100% 15.000 21.000 N Trp53bp1 n/a
2 TRCN0000081780 CCGCGTCATCACAGATGTTTA pLKO.1 4016 CDS 100% 13.200 18.480 N Trp53bp1 n/a
3 TRCN0000321584 CTATTGGGATTAGCAACTATC pLKO_005 3058 CDS 100% 10.800 15.120 N Trp53bp1 n/a
4 TRCN0000081778 GCTATTGTGGAGATTGTGTTT pLKO.1 6063 3UTR 100% 4.950 6.930 N Trp53bp1 n/a
5 TRCN0000081781 GCGTAGAAGATATTTCACCTA pLKO.1 4375 CDS 100% 2.640 3.696 N Trp53bp1 n/a
6 TRCN0000321527 CAAGTCCTTCACCCGCATTAT pLKO_005 4412 CDS 100% 13.200 10.560 N Trp53bp1 n/a
7 TRCN0000081779 CCTCCTTTCAACAAGCAGTAT pLKO.1 5418 CDS 100% 4.950 3.960 N Trp53bp1 n/a
8 TRCN0000018865 GATACTTGGTCTTACTGGTTT pLKO.1 6034 3UTR 100% 4.950 3.960 N TP53BP1 n/a
9 TRCN0000229640 GATACTTGGTCTTACTGGTTT pLKO_005 6034 3UTR 100% 4.950 3.960 N TP53BP1 n/a
10 TRCN0000350573 TGAATGGACAGTGACTATAAA pLKO_005 6530 3UTR 100% 15.000 10.500 N Trp53bp1 n/a
11 TRCN0000321586 TGCCTAAAGAAGGTGATATTA pLKO_005 2965 CDS 100% 15.000 10.500 N Trp53bp1 n/a
12 TRCN0000081782 CGCGTCATCACAGATGTTTAT pLKO.1 4017 CDS 100% 13.200 9.240 N Trp53bp1 n/a
13 TRCN0000018866 CCAGTGTGATTAGTATTGATT pLKO.1 2407 CDS 100% 5.625 3.938 N TP53BP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011239584.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000465716 CCCGCTAGCACTCTAGGATCTGGA pLX_317 5.5% 80.9% .4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV