Transcript: Mouse XM_011239935.1

PREDICTED: Mus musculus ADP-ribosylation factor GTPase activating protein 1 (Arfgap1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Arfgap1 (228998)
Length:
2456
CDS:
92..1366

Additional Resources:

NCBI RefSeq record:
XM_011239935.1
NBCI Gene record:
Arfgap1 (228998)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011239935.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000100754 GCACAGGATGAGAATAATGTT pLKO.1 134 CDS 100% 5.625 7.875 N Arfgap1 n/a
2 TRCN0000100751 GCGCTCTGTTACAATGGACAA pLKO.1 268 CDS 100% 4.050 3.240 N Arfgap1 n/a
3 TRCN0000437936 GAAAGTGCCTGGAGCCTTAAA pLKO_005 1725 3UTR 100% 13.200 9.240 N Arfgap1 n/a
4 TRCN0000431879 GCTACTTTGGCAGAAGGTAAA pLKO_005 437 CDS 100% 10.800 7.560 N Arfgap1 n/a
5 TRCN0000442884 AGCAAAGGAGGGTGCTACAAA pLKO_005 763 CDS 100% 5.625 3.938 N Arfgap1 n/a
6 TRCN0000100752 GCGTGATGTCACTACTTTCTT pLKO.1 982 CDS 100% 5.625 3.938 N Arfgap1 n/a
7 TRCN0000100753 GCTCAGGAGAATCGCTATGTA pLKO.1 623 CDS 100% 5.625 3.938 N Arfgap1 n/a
8 TRCN0000047321 GAATGCTAAGTTCCGAGAGTT pLKO.1 328 CDS 100% 4.950 3.465 N ARFGAP1 n/a
9 TRCN0000100750 GCCCTCAGTTAAATGGGACAA pLKO.1 1881 3UTR 100% 4.050 2.835 N Arfgap1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011239935.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03644 pDONR223 100% 83.4% 84.9% None (many diffs) n/a
2 ccsbBroad304_03644 pLX_304 0% 83.4% 84.9% V5 (many diffs) n/a
3 TRCN0000470622 CCATGCCGACCTGTAGCTGACCCT pLX_317 33.9% 83.4% 84.9% V5 (many diffs) n/a
Download CSV