Transcript: Mouse XM_011239936.1

PREDICTED: Mus musculus ADP-ribosylation factor GTPase activating protein 1 (Arfgap1), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Arfgap1 (228998)
Length:
1996
CDS:
1..906

Additional Resources:

NCBI RefSeq record:
XM_011239936.1
NBCI Gene record:
Arfgap1 (228998)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011239936.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437936 GAAAGTGCCTGGAGCCTTAAA pLKO_005 1265 3UTR 100% 13.200 9.240 N Arfgap1 n/a
2 TRCN0000442884 AGCAAAGGAGGGTGCTACAAA pLKO_005 333 CDS 100% 5.625 3.938 N Arfgap1 n/a
3 TRCN0000100752 GCGTGATGTCACTACTTTCTT pLKO.1 522 CDS 100% 5.625 3.938 N Arfgap1 n/a
4 TRCN0000100753 GCTCAGGAGAATCGCTATGTA pLKO.1 193 CDS 100% 5.625 3.938 N Arfgap1 n/a
5 TRCN0000100750 GCCCTCAGTTAAATGGGACAA pLKO.1 1421 3UTR 100% 4.050 2.835 N Arfgap1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011239936.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03644 pDONR223 100% 57.8% 52.5% None (many diffs) n/a
2 ccsbBroad304_03644 pLX_304 0% 57.8% 52.5% V5 (many diffs) n/a
3 TRCN0000470622 CCATGCCGACCTGTAGCTGACCCT pLX_317 33.9% 57.8% 52.5% V5 (many diffs) n/a
Download CSV