Transcript: Mouse XM_011240165.1

PREDICTED: Mus musculus GIPC PDZ domain containing family, member 2 (Gipc2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gipc2 (54120)
Length:
1082
CDS:
106..774

Additional Resources:

NCBI RefSeq record:
XM_011240165.1
NBCI Gene record:
Gipc2 (54120)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011240165.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000097812 GCAATCGGAAAGGTTGATGAT pLKO.1 565 CDS 100% 4.950 6.930 N Gipc2 n/a
2 TRCN0000332478 GCAATCGGAAAGGTTGATGAT pLKO_005 565 CDS 100% 4.950 6.930 N Gipc2 n/a
3 TRCN0000097813 TGTACCTTAAATACGCCTAAA pLKO.1 79 5UTR 100% 10.800 7.560 N Gipc2 n/a
4 TRCN0000332477 TGTACCTTAAATACGCCTAAA pLKO_005 79 5UTR 100% 10.800 7.560 N Gipc2 n/a
5 TRCN0000097810 CACTGTTATGAACTCTACTTT pLKO.1 841 3UTR 100% 5.625 3.938 N Gipc2 n/a
6 TRCN0000332549 CACTGTTATGAACTCTACTTT pLKO_005 841 3UTR 100% 5.625 3.938 N Gipc2 n/a
7 TRCN0000097814 GAGCTCTTTACTTTGCAGTTA pLKO.1 394 CDS 100% 4.950 3.465 N Gipc2 n/a
8 TRCN0000332479 GAGCTCTTTACTTTGCAGTTA pLKO_005 394 CDS 100% 4.950 3.465 N Gipc2 n/a
9 TRCN0000097811 GCGTCACTTTGAAGTCGCTAA pLKO.1 348 CDS 100% 4.050 2.835 N Gipc2 n/a
10 TRCN0000332560 GCGTCACTTTGAAGTCGCTAA pLKO_005 348 CDS 100% 4.050 2.835 N Gipc2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011240165.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08411 pDONR223 100% 57.8% 60.9% None (many diffs) n/a
2 ccsbBroad304_08411 pLX_304 0% 57.8% 60.9% V5 (many diffs) n/a
3 TRCN0000469263 CAGGATGACTGCGGTTACCCACAG pLX_317 36.2% 57.8% 60.9% V5 (many diffs) n/a
Download CSV