Transcript: Mouse XM_011240521.1

PREDICTED: Mus musculus argonaute RISC catalytic subunit 1 (Ago1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ago1 (236511)
Length:
6921
CDS:
301..2430

Additional Resources:

NCBI RefSeq record:
XM_011240521.1
NBCI Gene record:
Ago1 (236511)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011240521.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000009629 CCATTTGAGTTCGACTTCTAT pLKO.1 2077 CDS 100% 5.625 7.875 N Ago1 n/a
2 TRCN0000009625 CGCGGGAAACAGTTCTACAAT pLKO.1 1162 CDS 100% 5.625 7.875 N Ago1 n/a
3 TRCN0000435961 ATTGAAGACTTGTCCTATATG pLKO_005 1765 CDS 100% 13.200 9.240 N Ago1 n/a
4 TRCN0000415676 ACAATGGGATTGAGATCAAAG pLKO_005 1178 CDS 100% 10.800 7.560 N AGO1 n/a
5 TRCN0000413322 TTGAAGGCAGAACGCTGTTAC pLKO_005 2427 CDS 100% 10.800 7.560 N Ago1 n/a
6 TRCN0000009626 GCTGACAAGAATGAGCGGATT pLKO.1 2002 CDS 100% 4.050 2.835 N Ago1 n/a
7 TRCN0000007861 GCACAGTATTTCAAGCAGAAA pLKO.1 766 CDS 100% 4.950 2.970 N AGO1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011240521.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08023 pDONR223 100% 76.1% 80% None (many diffs) n/a
2 ccsbBroad304_08023 pLX_304 0% 76.1% 80% V5 (many diffs) n/a
3 TRCN0000477689 GGCCTGACAATTTGTCATGTACTC pLX_317 19.9% 76.1% 80% V5 (many diffs) n/a
4 ccsbBroadEn_11852 pDONR223 100% 42.9% 47.6% None (many diffs) n/a
5 ccsbBroad304_11852 pLX_304 0% 42.9% 47.6% V5 (many diffs) n/a
Download CSV