Transcript: Mouse XM_011240718.2

PREDICTED: Mus musculus tec protein tyrosine kinase (Tec), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tec (21682)
Length:
2726
CDS:
276..2168

Additional Resources:

NCBI RefSeq record:
XM_011240718.2
NBCI Gene record:
Tec (21682)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011240718.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000322037 TGCCGGCTTCAGCTATGATAA pLKO_005 1337 CDS 100% 13.200 18.480 N Tec n/a
2 TRCN0000322101 GTGTGCCATCGGAACGCAATT pLKO_005 2206 3UTR 100% 10.800 15.120 N Tec n/a
3 TRCN0000023678 GTCTCCCTTTACACAAAGTTT pLKO.1 1119 CDS 100% 5.625 7.875 N Tec n/a
4 TRCN0000023677 CGTACGATAGATGAACTAGTT pLKO.1 2121 CDS 100% 0.000 0.000 N Tec n/a
5 TRCN0000322100 CGTACGATAGATGAACTAGTT pLKO_005 2121 CDS 100% 0.000 0.000 N Tec n/a
6 TRCN0000322039 CATCAGGTTTCAGGCATTATC pLKO_005 1153 CDS 100% 13.200 9.240 N Tec n/a
7 TRCN0000196560 GAAGGATATATCCCAAGTAAT pLKO.1 948 CDS 100% 13.200 9.240 N TEC n/a
8 TRCN0000322038 TTGGTGGAGAGCGAGAGATAA pLKO_005 917 CDS 100% 13.200 9.240 N Tec n/a
9 TRCN0000023674 GCCAGAAATTGTCTAGTGAAT pLKO.1 1746 CDS 100% 4.950 3.465 N Tec n/a
10 TRCN0000023676 GCCCTTTGAGAAGAACACCAA pLKO.1 1964 CDS 100% 2.640 1.848 N Tec n/a
11 TRCN0000023675 CCGATGGGTGAAGAAGTTAAA pLKO.1 575 CDS 100% 13.200 7.920 N Tec n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011240718.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488805 TTTTCTCAAGTCATATTGCATGAA pLX_317 16.9% 88.9% 95% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_14859 pDONR223 0% 88.9% 95% None (many diffs) n/a
3 TRCN0000473405 CGGCTAAAATTGACTCAAGCCGTC pLX_317 24.2% 88.9% 95% V5 (many diffs) n/a
Download CSV