Transcript: Mouse XM_011240730.1

PREDICTED: Mus musculus sel-1 suppressor of lin-12-like 3 (C. elegans) (Sel1l3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sel1l3 (231238)
Length:
4406
CDS:
515..3454

Additional Resources:

NCBI RefSeq record:
XM_011240730.1
NBCI Gene record:
Sel1l3 (231238)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011240730.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000216156 CTTCTATGAAACTGGATTAAA pLKO.1 1789 CDS 100% 15.000 21.000 N Sel1l3 n/a
2 TRCN0000264847 CTTCTATGAAACTGGATTAAA pLKO_005 1789 CDS 100% 15.000 21.000 N Sel1l3 n/a
3 TRCN0000264848 ACATTATTGGGTATCGTTTAT pLKO_005 4040 3UTR 100% 13.200 10.560 N Sel1l3 n/a
4 TRCN0000264849 TGGTGTACAGGGATGACTATT pLKO_005 516 CDS 100% 13.200 10.560 N Sel1l3 n/a
5 TRCN0000202279 GACGGCAGTTTGCACATTCAA pLKO.1 1034 CDS 100% 5.625 4.500 N Sel1l3 n/a
6 TRCN0000216847 GAAGTCTCCGTGGAGTATTTA pLKO.1 347 5UTR 100% 15.000 10.500 N Sel1l3 n/a
7 TRCN0000264846 GAAGTCTCCGTGGAGTATTTA pLKO_005 347 5UTR 100% 15.000 10.500 N Sel1l3 n/a
8 TRCN0000191742 GCTACCATAATCAGACCATTA pLKO.1 1191 CDS 100% 10.800 7.560 N Sel1l3 n/a
9 TRCN0000193043 GCAATGGAATACGCAGACAAA pLKO.1 4155 3UTR 100% 4.950 3.465 N Sel1l3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011240730.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11701 pDONR223 100% 86.1% 87.2% None (many diffs) n/a
2 ccsbBroad304_11701 pLX_304 0% 86.1% 87.2% V5 (many diffs) n/a
3 TRCN0000479888 TTGTCTTGTGTTTTTGCACATTTA pLX_317 13.8% 86.1% 87.2% V5 (many diffs) n/a
Download CSV