Transcript: Mouse XM_011241016.1

PREDICTED: Mus musculus SMAD specific E3 ubiquitin protein ligase 1 (Smurf1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Smurf1 (75788)
Length:
5397
CDS:
271..2535

Additional Resources:

NCBI RefSeq record:
XM_011241016.1
NBCI Gene record:
Smurf1 (75788)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011241016.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000040573 CCAGTATTCCACGGACAATAT pLKO.1 1659 CDS 100% 13.200 18.480 N Smurf1 n/a
2 TRCN0000040577 CAGCACTATGACCTGTATGTT pLKO.1 460 CDS 100% 5.625 3.938 N Smurf1 n/a
3 TRCN0000040574 GCCAAGAACCTTGCAAAGAAA pLKO.1 334 CDS 100% 5.625 3.938 N Smurf1 n/a
4 TRCN0000003473 CTGGAGGTTTATGAGAGGAAT pLKO.1 2049 CDS 100% 4.950 3.465 N SMURF1 n/a
5 TRCN0000040575 GCTGGATAAGATAGACCTGAA pLKO.1 2172 CDS 100% 4.050 2.835 N Smurf1 n/a
6 TRCN0000040576 CCATGAAATGTTGAACCCGTA pLKO.1 1626 CDS 100% 2.160 1.512 N Smurf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011241016.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000492102 CAGGTTCCCTGAGCTGCACGAGTC pLX_317 17.1% 84.9% 94.8% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000489654 TTTCACGGAGCTGCGCAATGCGCC pLX_317 18% 84.9% 94.7% V5 (many diffs) n/a
Download CSV