Transcript: Mouse XM_011241117.1

PREDICTED: Mus musculus ribosomal modification protein rimK-like family member B (Rimklb), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rimklb (108653)
Length:
5332
CDS:
197..1360

Additional Resources:

NCBI RefSeq record:
XM_011241117.1
NBCI Gene record:
Rimklb (108653)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011241117.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000267619 CTTTGCTCAATGATCATATTT pLKO_005 3287 3UTR 100% 15.000 10.500 N Rimklb n/a
2 TRCN0000252845 ATCTGGTTGCCACTTACATTA pLKO_005 3373 3UTR 100% 13.200 9.240 N Rimklb n/a
3 TRCN0000252844 GCCACTTACATTATGATATAC pLKO_005 3381 3UTR 100% 13.200 9.240 N Rimklb n/a
4 TRCN0000267477 TTTGCAGGGTGCATGGTATTT pLKO_005 3306 3UTR 100% 13.200 9.240 N Rimklb n/a
5 TRCN0000267588 TACTTGGTACTTTGCTCAATG pLKO_005 3278 3UTR 100% 10.800 7.560 N Rimklb n/a
6 TRCN0000140297 GATGAAAGATGACGGCTCCTT pLKO.1 994 CDS 100% 2.640 1.848 N RIMKLB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011241117.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12352 pDONR223 100% 66.7% 71.6% None (many diffs) n/a
2 ccsbBroad304_12352 pLX_304 0% 66.7% 71.6% V5 (many diffs) n/a
3 TRCN0000472196 TGGTCCTCCGCTTATAAGAGGATC pLX_317 57.9% 66.7% 71.6% V5 (many diffs) n/a
Download CSV