Transcript: Mouse XM_011241204.2

PREDICTED: Mus musculus epidermal growth factor receptor pathway substrate 8 (Eps8), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Eps8 (13860)
Length:
3860
CDS:
51..2516

Additional Resources:

NCBI RefSeq record:
XM_011241204.2
NBCI Gene record:
Eps8 (13860)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011241204.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000092276 CGCCAAATCCAAGTACGACTT pLKO.1 1652 CDS 100% 4.050 5.670 N Eps8 n/a
2 TRCN0000317733 CGCCAAATCCAAGTACGACTT pLKO_005 1652 CDS 100% 4.050 5.670 N Eps8 n/a
3 TRCN0000319547 GAACGTTCCAGTGATCAATAT pLKO_005 2189 CDS 100% 13.200 9.240 N Eps8 n/a
4 TRCN0000092277 GCTGCTTTGGAGGACAGTAAT pLKO.1 2391 CDS 100% 13.200 9.240 N Eps8 n/a
5 TRCN0000319470 TCACTGTCGAGGACGGAATAA pLKO_005 295 CDS 100% 13.200 9.240 N Eps8 n/a
6 TRCN0000319469 AGCCTTGTTCGATGATCTAAG pLKO_005 2981 3UTR 100% 10.800 7.560 N Eps8 n/a
7 TRCN0000319543 GTAATGGAAGCTCCGAGTTAC pLKO_005 2407 CDS 100% 10.800 7.560 N Eps8 n/a
8 TRCN0000092274 CGGAATAAGAAAGCTGAAGTT pLKO.1 308 CDS 100% 4.950 3.465 N Eps8 n/a
9 TRCN0000092275 GCCTTTCAAGTCAACTCCTAA pLKO.1 1580 CDS 100% 4.950 3.465 N Eps8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011241204.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06172 pDONR223 100% 84.4% 88.9% None (many diffs) n/a
2 ccsbBroad304_06172 pLX_304 0% 84.4% 88.9% V5 (many diffs) n/a
3 TRCN0000480737 CCTAAATCACCCTATCTGTTGCGG pLX_317 17% 84.4% 88.9% V5 (many diffs) n/a
Download CSV