Transcript: Mouse XM_011241301.2

PREDICTED: Mus musculus IQ motif and Sec7 domain 1 (Iqsec1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Iqsec1 (232227)
Length:
6543
CDS:
118..3684

Additional Resources:

NCBI RefSeq record:
XM_011241301.2
NBCI Gene record:
Iqsec1 (232227)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011241301.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000340710 GTGATGAAATACGTAAGTAAA pLKO_005 4117 3UTR 100% 13.200 18.480 N Iqsec1 n/a
2 TRCN0000340709 AGACGCTAATTGGGATCTATG pLKO_005 2429 CDS 100% 10.800 15.120 N Iqsec1 n/a
3 TRCN0000340708 CAACTCCAATGACACCATAAA pLKO_005 1767 CDS 100% 13.200 10.560 N Iqsec1 n/a
4 TRCN0000340707 AGACATCAAAGTGCTAATAAA pLKO_005 2838 CDS 100% 15.000 10.500 N Iqsec1 n/a
5 TRCN0000340630 ATTACCGAATTGGCCTAAATC pLKO_005 1916 CDS 100% 13.200 9.240 N Iqsec1 n/a
6 TRCN0000201068 CCAGTGTTACTGTTGGCAAAT pLKO.1 5740 3UTR 100% 10.800 7.560 N Iqsec1 n/a
7 TRCN0000190331 CTGTCAGCATGGCTCATCTTT pLKO.1 5489 3UTR 100% 5.625 3.938 N Iqsec1 n/a
8 TRCN0000191975 GAAAGAGAACTGATCACCATA pLKO.1 5527 3UTR 100% 4.950 3.465 N Iqsec1 n/a
9 TRCN0000192386 CCTTTCAGATTGGAAGGAGTT pLKO.1 5204 3UTR 100% 4.050 2.835 N Iqsec1 n/a
10 TRCN0000201658 CCCTTTCAGATTGGAAGGAGT pLKO.1 5203 3UTR 100% 2.640 1.848 N Iqsec1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011241301.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14033 pDONR223 100% 60.5% 65.3% None (many diffs) n/a
2 ccsbBroad304_14033 pLX_304 0% 60.5% 65.3% V5 (many diffs) n/a
3 TRCN0000481156 GCCGTCTCGGCATATTACACGAAA pLX_317 15.3% 60.5% 65.3% V5 (many diffs) n/a
Download CSV