Construct: ORF TRCN0000481156
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018246.2_s317c1
- Derived from:
- ccsbBroadEn_14033
- DNA Barcode:
- GCCGTCTCGGCATATTACACGAAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- IQSEC1 (9922)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000481156
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 9922 | IQSEC1 | IQ motif and Sec7 domain Ar... | NM_001330619.2 | 99.9% | 99.8% | 740A>N |
2 | human | 9922 | IQSEC1 | IQ motif and Sec7 domain Ar... | XM_024453846.1 | 99.9% | 99.8% | 740A>N |
3 | human | 9922 | IQSEC1 | IQ motif and Sec7 domain Ar... | NM_014869.7 | 84.4% | 84.1% | (many diffs) |
4 | human | 9922 | IQSEC1 | IQ motif and Sec7 domain Ar... | XM_011534311.2 | 80.8% | 80.5% | 740A>N;2432_2481del;2493_3018del |
5 | human | 9922 | IQSEC1 | IQ motif and Sec7 domain Ar... | XM_011534312.2 | 80.8% | 80.5% | 740A>N;2432_2481del;2493_3018del |
6 | human | 9922 | IQSEC1 | IQ motif and Sec7 domain Ar... | XM_011534313.2 | 80.8% | 80.5% | 740A>N;2432_2481del;2493_3018del |
7 | human | 9922 | IQSEC1 | IQ motif and Sec7 domain Ar... | XM_011534314.2 | 80.8% | 80.5% | 740A>N;2432_2481del;2493_3018del |
8 | human | 9922 | IQSEC1 | IQ motif and Sec7 domain Ar... | XM_024453845.1 | 79.8% | 79.5% | (many diffs) |
9 | human | 9922 | IQSEC1 | IQ motif and Sec7 domain Ar... | NM_001134382.3 | 73% | 72.7% | (many diffs) |
10 | human | 9922 | IQSEC1 | IQ motif and Sec7 domain Ar... | XM_011534308.2 | 72.1% | 71.8% | (many diffs) |
11 | human | 9922 | IQSEC1 | IQ motif and Sec7 domain Ar... | XM_011534306.3 | 72% | 71.7% | (many diffs) |
12 | human | 9922 | IQSEC1 | IQ motif and Sec7 domain Ar... | XM_011534307.2 | 72% | 71.7% | (many diffs) |
13 | human | 9922 | IQSEC1 | IQ motif and Sec7 domain Ar... | XM_011534305.2 | 71.8% | 71.5% | (many diffs) |
14 | mouse | 232227 | Iqsec1 | IQ motif and Sec7 domain 1 | XM_017321534.1 | 75.8% | 81.9% | (many diffs) |
15 | mouse | 232227 | Iqsec1 | IQ motif and Sec7 domain 1 | NM_001134383.1 | 74.7% | 80.7% | (many diffs) |
16 | mouse | 232227 | Iqsec1 | IQ motif and Sec7 domain 1 | XM_006505992.2 | 72.4% | 78.2% | (many diffs) |
17 | mouse | 232227 | Iqsec1 | IQ motif and Sec7 domain 1 | XM_017321532.1 | 72.4% | 78.2% | (many diffs) |
18 | mouse | 232227 | Iqsec1 | IQ motif and Sec7 domain 1 | XM_017321533.1 | 72.4% | 78.2% | (many diffs) |
19 | mouse | 232227 | Iqsec1 | IQ motif and Sec7 domain 1 | XM_006505991.3 | 70.1% | 76% | (many diffs) |
20 | mouse | 232227 | Iqsec1 | IQ motif and Sec7 domain 1 | XM_006505990.3 | 68.3% | 73.8% | (many diffs) |
21 | mouse | 232227 | Iqsec1 | IQ motif and Sec7 domain 1 | XM_011241302.2 | 67.3% | 72.8% | (many diffs) |
22 | mouse | 232227 | Iqsec1 | IQ motif and Sec7 domain 1 | NM_001134384.1 | 65.4% | 70.6% | (many diffs) |
23 | mouse | 232227 | Iqsec1 | IQ motif and Sec7 domain 1 | XM_006505988.3 | 64.5% | 69.7% | (many diffs) |
24 | mouse | 232227 | Iqsec1 | IQ motif and Sec7 domain 1 | XM_006505986.3 | 64.5% | 69.6% | (many diffs) |
25 | mouse | 232227 | Iqsec1 | IQ motif and Sec7 domain 1 | XM_006505987.3 | 64.5% | 69.6% | (many diffs) |
26 | mouse | 232227 | Iqsec1 | IQ motif and Sec7 domain 1 | XM_006505985.3 | 64.3% | 69.4% | (many diffs) |
27 | mouse | 232227 | Iqsec1 | IQ motif and Sec7 domain 1 | XM_011241301.2 | 60.5% | 65.3% | (many diffs) |
28 | mouse | 232227 | Iqsec1 | IQ motif and Sec7 domain 1 | XM_006505984.3 | 60.2% | 65% | (many diffs) |
29 | mouse | 232227 | Iqsec1 | IQ motif and Sec7 domain 1 | XM_006505983.3 | 59.7% | 64.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 2508
- ORF length:
- 2442
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgct agaacgaaag tatggggggc gcctggtaac ccgccatgcg gcccgcacca 121 tccagacggc gtttcgccag taccagatga acaagaactt cgagcgcttg cgcagctcca 181 tgtcagagaa ccgcatgtca cgccggattg tgctgtccaa catgaggatg cagttctcct 241 ttgaggggcc tgagaaagtg cacagctcct acttcgaggg gaagcaggtc tcagtgacta 301 acgacggctc ccagctggga gccctggtgt cccctgagtg tggtgacctc agcgagccca 361 ccaccctcaa gtctccggcc ccctccagtg actttgcgga cgccatcacc gagctggagg 421 acgccttctc taggcaagtg aaatcactgg ccgagtccat cgacgatgcc ctcaactgcc 481 gcagcctgca cactgaggag gcaccggccc tggatgcggc gcgggcccgg gacaccgaac 541 cccagacagc cctgcacggc atggaccacc gcaaactgga cgagatgacg gcctcgtaca 601 gtgatgtcac cctgtacatc gatgaggagg agctgtcgcc ccctctgccc ctctcgcagg 661 caggggaccg gccgtccagc accgagtcgg acctgcggct acgggctggg ggcgcagccc 721 cagactactg ggccctggcc cacaaagagg acaaggctga cacggacacg agctgccgga 781 gcacgccgtc gctggagcgg caggngcagc ggctgcgggt ggagcatctg ccgctgctca 841 ccatcgagcc acccagcgac agctctgtgg accttagtga ccgctcggag cgggggtcac 901 tcaagaggca gagtgcttac gagcgcagcc ttggcgggca gcagggcagt cccaagcatg 961 gtccccacag cggcgccccc aagagcctcc cccgggagga gcctgagttg cggccccggc 1021 cccccaggcc cctggacagc cacttggcca tcaatggctc agccaaccgg cagagcaagt 1081 ctgagtcgga ctactcagac ggtgacaatg acagcatcaa cagcacgtcc aactccaacg 1141 ataccatcaa ctgcagctcc gagtcatcgt cccgtgacag cctgcgggag cagacgctca 1201 gcaagcagac ctaccacaag gaggcccgca acagctggga ctcgcctgcc tttagcaacg 1261 atgtcatccg caagaggcac taccgcatcg gcctgaacct cttcaacaag aagcctgaga 1321 agggagtcca gtacctcatc gagcgtggct ttgtgcccga cacgcccgtc ggggtggccc 1381 acttcctgct gcagcgcaag ggcctcagcc ggcagatgat cggcgagttc ctgggcaacc 1441 ggcagaagca gttcaaccgt gacgtgctcg actgcgtcgt ggacgagatg gacttctcta 1501 ccatggagct ggatgaggcc ctcaggaaat tccaggcgca catccgtgtc caaggggagg 1561 ctcagaaagt ggagcggctc atagaggcgt tcagccagcg ctactgcatc tgcaaccctg 1621 gggtggtgcg gcaattccgg aacccagaca ccattttcat cctggccttc gccatcatcc 1681 tgctgaacac cgacatgtac agccccaatg tcaagcccga gcggaaaatg aagctagagg 1741 acttcatcaa gaacctccga ggtgtggacg atggtgagga cattccccgt gagatgctga 1801 tggggatcta tgaacggatc cgtaagcgag agctaaagac caatgaggac catgtgtccc 1861 aggtgcagaa ggtggagaag ctcattgtgg ggaaaaagcc gatcggatcc ctgcatcccg 1921 ggctcggctg tgtgctctct ctgccccacc gtcggttggt ctgctactgc cggctctttg 1981 aggttccaga cccaaacaag ccccagaaac tcggactaca ccagcgagaa atcttcctgt 2041 tcaacgacct cctggtggtc accaagatct tccagaagaa gaagaactcg gtgacgtaca 2101 gcttccgaca gtccttctcc ttgtacggca tgcaggtccT GCTCTTCGAG AACCAGTACT 2161 ACCCCAATGG CATCCGGCTC ACCTCGTCTG TCCCCGGAGC AGATATCAAA GTGTTAATAA 2221 ACTTCAACGC CCCCAACCCT CAAGACCGGA AGAAATTCAC CGATGACCTG CGGGAGTCCA 2281 TTGCGGAAGT CCAAGAGATG GAGAAGCACA GGATAGAGTC GGAGCTCGAG AAGCAGAAAG 2341 GCGTCGTGCG GCCCAGCATG TCCCAGTGCT CTAGCCTCAA AAAGGAGTCG GGCAACGGAA 2401 CACTGAGCCG GGCCTGCCTG GACGACAGCT ATGCCAGCGG TGAGGGCCTC AAGCGCAGCG 2461 CCCTCAGCAG CTCCCTGCGG GACCTCTCGG AAGCCGGGGT CCATCATTAC CCAACTTTCT 2521 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 2581 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 2641 GTGGAAAGGA CGAGCCGTCT CGGCATATTA CACGAAAACG CGTTAAGTCg acaatcaacc 2701 tctggattac aaaatttgtg aaagatt