Transcript: Mouse XM_011241867.1

PREDICTED: Mus musculus RIKEN cDNA 1110004F10 gene (1110004F10Rik), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
1110004F10Rik (56372)
Length:
1275
CDS:
16..504

Additional Resources:

NCBI RefSeq record:
XM_011241867.1
NBCI Gene record:
1110004F10Rik (56372)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011241867.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000266844 AGATGCGAAGAGCAATTATAA pLKO_005 453 CDS 100% 15.000 12.000 N 1110004F10Rik n/a
2 TRCN0000283337 TCCTAACTACCAAACACTTAG pLKO_005 499 CDS 100% 10.800 8.640 N 1110004F10Rik n/a
3 TRCN0000266847 TTCTCCAGGCATGACTATAAC pLKO_005 663 3UTR 100% 13.200 9.240 N 1110004F10Rik n/a
4 TRCN0000266845 TTGTTATAGGAGATCACAAAT pLKO_005 125 CDS 100% 13.200 9.240 N 1110004F10Rik n/a
5 TRCN0000184523 GAGTCTGCAGAAGAGCTTCAT pLKO.1 388 CDS 100% 4.950 3.465 N 1110004F10Rik n/a
6 TRCN0000130757 GCTTTCAAATGCCATGGGTTA pLKO.1 639 3UTR 100% 4.050 2.835 N C11orf58 n/a
7 TRCN0000292212 GCTTTCAAATGCCATGGGTTA pLKO_005 639 3UTR 100% 4.050 2.835 N C11orf58 n/a
8 TRCN0000183225 GTAGAAGATCATGATGGAGAA pLKO.1 277 CDS 100% 4.050 2.835 N 1110004F10Rik n/a
9 TRCN0000179193 GCAGGAAAGAAAGAACACACT pLKO.1 97 CDS 100% 2.640 1.848 N 1110004F10Rik n/a
10 TRCN0000216967 CAAATGCCATGGGTTACATTT pLKO.1 644 3UTR 100% 1.320 0.924 N 1110004F10Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011241867.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02567 pDONR223 100% 76.8% 83.6% None (many diffs) n/a
2 ccsbBroad304_02567 pLX_304 0% 76.8% 83.6% V5 (many diffs) n/a
3 TRCN0000470050 GCGGTGGTACATGGCCCCTTATCG pLX_317 81.5% 76.8% 83.6% V5 (many diffs) n/a
Download CSV