Transcript: Mouse XM_011241952.2

PREDICTED: Mus musculus major vault protein (Mvp), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mvp (78388)
Length:
2782
CDS:
78..2663

Additional Resources:

NCBI RefSeq record:
XM_011241952.2
NBCI Gene record:
Mvp (78388)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011241952.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000175229 CCATCGAAATTACAACCAACT pLKO.1 2059 CDS 100% 4.050 5.670 N Mvp n/a
2 TRCN0000298056 CCATCGAAATTACAACCAACT pLKO_005 2059 CDS 100% 4.050 5.670 N Mvp n/a
3 TRCN0000173665 CGTATCATTCGCATGGCTGTT pLKO.1 1866 CDS 100% 4.050 5.670 N Mvp n/a
4 TRCN0000292795 CGTATCATTCGCATGGCTGTT pLKO_005 1866 CDS 100% 4.050 5.670 N Mvp n/a
5 TRCN0000173596 GCCCAGAGTTCTGTGTTGTTT pLKO.1 282 CDS 100% 5.625 3.938 N Mvp n/a
6 TRCN0000292853 GCCCAGAGTTCTGTGTTGTTT pLKO_005 282 CDS 100% 5.625 3.938 N Mvp n/a
7 TRCN0000194443 GTGGAAGTCGTGGAGATCATT pLKO.1 546 CDS 100% 5.625 3.938 N Mvp n/a
8 TRCN0000180269 CCCATCAACCTCTTCAACACA pLKO.1 2589 CDS 100% 3.000 2.100 N MVP n/a
9 TRCN0000281108 CCCATCAACCTCTTCAACACA pLKO_005 2589 CDS 100% 3.000 2.100 N MVP n/a
10 TRCN0000175981 GCATCTATGTTCAGGATGTCA pLKO.1 1237 CDS 100% 3.000 1.800 N Mvp n/a
11 TRCN0000292855 GCATCTATGTTCAGGATGTCA pLKO_005 1237 CDS 100% 3.000 1.800 N Mvp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011241952.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02276 pDONR223 100% 83.4% 88.1% None (many diffs) n/a
2 ccsbBroad304_02276 pLX_304 0% 83.4% 88.1% V5 (many diffs) n/a
3 TRCN0000473574 ACCCATGACGATAAGAGAGACGCG pLX_317 18.4% 83.4% 88.1% V5 (many diffs) n/a
Download CSV