Transcript: Mouse XM_011243067.2

PREDICTED: Mus musculus estrogen receptor 1 (alpha) (Esr1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Esr1 (13982)
Length:
2231
CDS:
199..1998

Additional Resources:

NCBI RefSeq record:
XM_011243067.2
NBCI Gene record:
Esr1 (13982)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011243067.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000026176 CCGCCTTCTACAGGTCTAATT pLKO.1 650 CDS 100% 13.200 18.480 N Esr1 n/a
2 TRCN0000026184 CCCATGATCTATTCTGAATAT pLKO.1 1183 CDS 100% 13.200 9.240 N Esr1 n/a
3 TRCN0000026197 GCTTTCTTTAAGAGAAGCATT pLKO.1 829 CDS 100% 4.950 3.465 N Esr1 n/a
4 TRCN0000026214 GCCGAAATGAAATGGGTGCTT pLKO.1 1037 CDS 100% 2.640 1.848 N Esr1 n/a
5 TRCN0000003298 GCCCTACTACCTGGAGAACGA pLKO.1 594 CDS 100% 0.880 0.616 N ESR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011243067.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00517 pDONR223 100% 85.6% 88.9% None (many diffs) n/a
2 ccsbBroad304_00517 pLX_304 26.5% 85.6% 88.9% V5 (many diffs) n/a
3 TRCN0000481482 CTTTAGAGGTAACGCATGAACATC pLX_317 28.9% 85.6% 88.9% V5 (many diffs) n/a
4 TRCN0000489098 TCCCTCCACCTGTGGTATTTTTAG pLX_317 18% 85.4% 88.9% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000489532 TCGTCCCGATAGTGAGTTAACGCC pLX_317 15.2% 84.8% 88% V5 (many diffs) n/a
Download CSV