Transcript: Mouse XM_011243398.2

PREDICTED: Mus musculus hexokinase domain containing 1 (Hkdc1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Hkdc1 (216019)
Length:
2756
CDS:
91..2118

Additional Resources:

NCBI RefSeq record:
XM_011243398.2
NBCI Gene record:
Hkdc1 (216019)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011243398.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221709 GCGCATGTACAACAAGATCTT pLKO.1 1020 CDS 100% 4.950 3.960 N Hkdc1 n/a
2 TRCN0000362052 GCACCTCCATTTGGCATATTT pLKO_005 2226 3UTR 100% 15.000 10.500 N Hkdc1 n/a
3 TRCN0000221707 CGTGTGCTACATGGAGGAAAT pLKO.1 1410 CDS 100% 10.800 7.560 N Hkdc1 n/a
4 TRCN0000361995 TCAAGAGGAGAAACGAGTTTG pLKO_005 1283 CDS 100% 10.800 7.560 N Hkdc1 n/a
5 TRCN0000379520 TCAAGAGGAGAAACGAGTTTG pLKO_005 1283 CDS 100% 10.800 7.560 N HKDC1 n/a
6 TRCN0000221708 GCCAAAGTTGGTCTCCTGTTT pLKO.1 310 CDS 100% 4.950 3.465 N Hkdc1 n/a
7 TRCN0000221711 GTGACATTTATGTTGTCAGAA pLKO.1 2023 CDS 100% 0.495 0.347 N Hkdc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011243398.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16002 pDONR223 0% 54.6% 57.7% None (many diffs) n/a
2 ccsbBroad304_16002 pLX_304 0% 54.6% 57.7% V5 (many diffs) n/a
3 TRCN0000474904 AGTGTCAATTGTCCCAGGATATAG pLX_317 31% 54.6% 57.7% V5 (many diffs) n/a
4 ccsbBroadEn_15165 pDONR223 0% 54.6% 57.7% None (many diffs) n/a
5 ccsbBroad304_15165 pLX_304 0% 54.6% 57.7% V5 (many diffs) n/a
6 TRCN0000480216 CCAAGCAGCCGCGCCGCGACTCTC pLX_317 28.9% 54.6% 57.7% V5 (many diffs) n/a
Download CSV