Transcript: Mouse XM_011243516.2

PREDICTED: Mus musculus poly(rC) binding protein 3 (Pcbp3), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pcbp3 (59093)
Length:
2688
CDS:
868..2052

Additional Resources:

NCBI RefSeq record:
XM_011243516.2
NBCI Gene record:
Pcbp3 (59093)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011243516.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000120932 GCAGATATGAATAGAGCGTTT pLKO.1 2143 3UTR 100% 4.050 5.670 N Pcbp3 n/a
2 TRCN0000340456 GCAGATATGAATAGAGCGTTT pLKO_005 2143 3UTR 100% 4.050 5.670 N Pcbp3 n/a
3 TRCN0000439892 GCACTCATGAGCTCACCATTC pLKO_005 1817 CDS 100% 6.000 4.800 N PCBP3 n/a
4 TRCN0000340457 AGTTTGAGGAGGACATCATTA pLKO_005 1196 CDS 100% 13.200 9.240 N Pcbp3 n/a
5 TRCN0000120936 TGATCTTATAGGCTGCATAAT pLKO.1 1842 CDS 100% 13.200 9.240 N Pcbp3 n/a
6 TRCN0000340517 TGATCTTATAGGCTGCATAAT pLKO_005 1842 CDS 100% 13.200 9.240 N Pcbp3 n/a
7 TRCN0000120933 CCCAGAGAGAATCGTTACAAT pLKO.1 1125 CDS 100% 5.625 3.938 N Pcbp3 n/a
8 TRCN0000340516 CCCAGAGAGAATCGTTACAAT pLKO_005 1125 CDS 100% 5.625 3.938 N Pcbp3 n/a
9 TRCN0000074700 CCTTGCCCAGTATCTCATCAA pLKO.1 1989 CDS 100% 4.950 3.465 N PCBP3 n/a
10 TRCN0000425115 CTTTACACTCCTCCGAAGAAG pLKO_005 1745 CDS 100% 4.950 3.465 N PCBP3 n/a
11 TRCN0000120935 CCCAGTATCTCATCAACGCTA pLKO.1 1994 CDS 100% 2.640 1.848 N Pcbp3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011243516.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12028 pDONR223 100% 73.8% 79.1% None (many diffs) n/a
2 ccsbBroad304_12028 pLX_304 0% 73.8% 79.1% V5 (many diffs) n/a
3 TRCN0000469904 ATGCCGTTAATTACTGGTAATACC pLX_317 37.5% 73.8% 79.1% V5 (many diffs) n/a
4 ccsbBroadEn_12029 pDONR223 100% 73.8% 79.1% None (many diffs) n/a
5 ccsbBroad304_12029 pLX_304 0% 73.8% 79.1% V5 (many diffs) n/a
6 TRCN0000479702 AGCGCCTTGAATTGTTTCTCACCC pLX_317 31.8% 73.8% 79.1% V5 (many diffs) n/a
Download CSV