Transcript: Mouse XM_011243686.2

PREDICTED: Mus musculus EH domain binding protein 1 (Ehbp1), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ehbp1 (216565)
Length:
5130
CDS:
574..4278

Additional Resources:

NCBI RefSeq record:
XM_011243686.2
NBCI Gene record:
Ehbp1 (216565)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011243686.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000306349 CACAAACTGACGTCAAGTTAA pLKO_005 962 CDS 100% 13.200 18.480 N Ehbp1 n/a
2 TRCN0000306287 GATCTCCGGACTGAACGATTA pLKO_005 3541 CDS 100% 10.800 15.120 N Ehbp1 n/a
3 TRCN0000090707 CGTGGAGGAATGGCTTATCAT pLKO.1 2015 CDS 100% 5.625 7.875 N Ehbp1 n/a
4 TRCN0000326655 CGTGGAGGAATGGCTTATCAT pLKO_005 2015 CDS 100% 5.625 7.875 N Ehbp1 n/a
5 TRCN0000090703 GCACCATCTTATACTCTGAAT pLKO.1 4976 3UTR 100% 4.950 3.960 N Ehbp1 n/a
6 TRCN0000306288 CCTTCTAAACTTGGATATAAC pLKO_005 2869 CDS 100% 13.200 9.240 N Ehbp1 n/a
7 TRCN0000306350 ATTGTTGGTAATAGCGAAATG pLKO_005 4636 3UTR 100% 10.800 7.560 N Ehbp1 n/a
8 TRCN0000090704 GCTATCACAAAGCCAAATGTA pLKO.1 2842 CDS 100% 5.625 3.938 N Ehbp1 n/a
9 TRCN0000090706 CGGATGAAGATATGCAGAGTT pLKO.1 1067 CDS 100% 4.950 3.465 N Ehbp1 n/a
10 TRCN0000090705 CCACTGTGAATACCAATCCAT pLKO.1 1361 CDS 100% 3.000 2.100 N Ehbp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011243686.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11715 pDONR223 100% 8% 8.5% None (many diffs) n/a
2 ccsbBroad304_11715 pLX_304 0% 8% 8.5% V5 (many diffs) n/a
3 TRCN0000473421 CTCTCTCTTATGAGCTGAGAACAT pLX_317 93.4% 8% 8.5% V5 (many diffs) n/a
Download CSV