Transcript: Mouse XM_011244134.2

PREDICTED: Mus musculus regulator of G-protein signaling 6 (Rgs6), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rgs6 (50779)
Length:
5885
CDS:
256..1914

Additional Resources:

NCBI RefSeq record:
XM_011244134.2
NBCI Gene record:
Rgs6 (50779)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011244134.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000037147 CAAGTGAAGATTGACCGGAAA pLKO.1 784 CDS 100% 4.050 5.670 N Rgs6 n/a
2 TRCN0000037144 CGGCGTTTGAAGAATCCACAA pLKO.1 916 CDS 100% 4.050 2.835 N Rgs6 n/a
3 TRCN0000037146 GCTTATGAAGAACCTTTCCAT pLKO.1 459 CDS 100% 3.000 2.100 N Rgs6 n/a
4 TRCN0000037148 GCTGATGAAGAGTGACAGCTA pLKO.1 1548 CDS 100% 2.640 1.848 N Rgs6 n/a
5 TRCN0000037145 CCAAGTGCAATCAACTTGGAT pLKO.1 1444 CDS 100% 0.300 0.210 N Rgs6 n/a
6 TRCN0000014319 GCTATGAGATAACCAGTCAAA pLKO.1 1472 CDS 100% 4.950 3.960 N RGS6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011244134.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02214 pDONR223 100% 78.6% 81.3% None (many diffs) n/a
2 ccsbBroad304_02214 pLX_304 0% 78.6% 81.3% V5 (many diffs) n/a
3 TRCN0000478246 ACGGACACCTGCAACTGCCCTCCG pLX_317 20.7% 78.6% 81.3% V5 (many diffs) n/a
Download CSV