Construct: ORF TRCN0000478246
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF000650.1_s317c1
- Derived from:
- ccsbBroadEn_02214
- DNA Barcode:
- ACGGACACCTGCAACTGCCCTCCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RGS6 (9628)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478246
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 9628 | RGS6 | regulator of G protein sign... | NM_001370287.1 | 100% | 100% | |
2 | human | 9628 | RGS6 | regulator of G protein sign... | NM_001370288.1 | 100% | 100% | |
3 | human | 9628 | RGS6 | regulator of G protein sign... | NM_001370289.1 | 100% | 100% | |
4 | human | 9628 | RGS6 | regulator of G protein sign... | NM_004296.7 | 100% | 100% | |
5 | human | 9628 | RGS6 | regulator of G protein sign... | XM_017021828.2 | 97.4% | 97% | (many diffs) |
6 | human | 9628 | RGS6 | regulator of G protein sign... | NM_001370290.1 | 97.3% | 96.2% | (many diffs) |
7 | human | 9628 | RGS6 | regulator of G protein sign... | NM_001370291.1 | 97.3% | 96.2% | (many diffs) |
8 | human | 9628 | RGS6 | regulator of G protein sign... | XM_017021830.2 | 97.3% | 96.2% | (many diffs) |
9 | human | 9628 | RGS6 | regulator of G protein sign... | XM_017021825.2 | 97% | 96.6% | (many diffs) |
10 | human | 9628 | RGS6 | regulator of G protein sign... | XM_017021826.2 | 96.9% | 96.8% | (many diffs) |
11 | human | 9628 | RGS6 | regulator of G protein sign... | XM_017021832.2 | 96.8% | 96.8% | (many diffs) |
12 | human | 9628 | RGS6 | regulator of G protein sign... | XM_017021827.2 | 96.7% | 96.8% | (many diffs) |
13 | human | 9628 | RGS6 | regulator of G protein sign... | NM_001204418.3 | 96.7% | 96.6% | (many diffs) |
14 | human | 9628 | RGS6 | regulator of G protein sign... | XM_024449774.1 | 96.7% | 96.6% | (many diffs) |
15 | human | 9628 | RGS6 | regulator of G protein sign... | NM_001204416.3 | 96.3% | 96.3% | 1368_1421del |
16 | human | 9628 | RGS6 | regulator of G protein sign... | NM_001204424.2 | 96.3% | 96.3% | 1368_1421del |
17 | human | 9628 | RGS6 | regulator of G protein sign... | NM_001370284.1 | 96.3% | 96.3% | 1368_1421del |
18 | human | 9628 | RGS6 | regulator of G protein sign... | NM_001204417.3 | 95.8% | 94.8% | (many diffs) |
19 | human | 9628 | RGS6 | regulator of G protein sign... | XM_024449770.1 | 95.8% | 94.8% | (many diffs) |
20 | human | 9628 | RGS6 | regulator of G protein sign... | XM_017021831.2 | 93.5% | 90.3% | (many diffs) |
21 | human | 9628 | RGS6 | regulator of G protein sign... | NM_001204423.2 | 92.5% | 92.5% | 0_1ins105 |
22 | human | 9628 | RGS6 | regulator of G protein sign... | NM_001204420.3 | 92.1% | 92.1% | 852_853ins111 |
23 | human | 9628 | RGS6 | regulator of G protein sign... | NM_001370292.1 | 92.1% | 92.1% | 852_853ins111 |
24 | human | 9628 | RGS6 | regulator of G protein sign... | NM_001370293.1 | 92.1% | 92.1% | 852_853ins111 |
25 | human | 9628 | RGS6 | regulator of G protein sign... | NM_001370282.1 | 89.2% | 88.3% | (many diffs) |
26 | human | 9628 | RGS6 | regulator of G protein sign... | XM_017021822.2 | 89% | 88.1% | (many diffs) |
27 | human | 9628 | RGS6 | regulator of G protein sign... | NM_001204422.3 | 88.9% | 88.8% | (many diffs) |
28 | human | 9628 | RGS6 | regulator of G protein sign... | NM_001204419.3 | 88.7% | 88.7% | 852_853ins111;1257_1310del |
29 | human | 9628 | RGS6 | regulator of G protein sign... | XM_024449776.1 | 88.7% | 88.7% | 852_853ins111;1257_1310del |
30 | human | 9628 | RGS6 | regulator of G protein sign... | NM_001204421.3 | 88.2% | 87.2% | (many diffs) |
31 | human | 9628 | RGS6 | regulator of G protein sign... | NM_001370281.1 | 87.4% | 86.4% | (many diffs) |
32 | human | 9628 | RGS6 | regulator of G protein sign... | NM_001370270.1 | 85.3% | 83.2% | 1368_1488del;1538_1659del |
33 | human | 9628 | RGS6 | regulator of G protein sign... | NM_001370271.1 | 85.3% | 83.2% | 1368_1488del;1538_1659del |
34 | human | 9628 | RGS6 | regulator of G protein sign... | NM_001370272.1 | 85.3% | 83.2% | 1368_1488del;1538_1659del |
35 | human | 9628 | RGS6 | regulator of G protein sign... | NM_001370273.1 | 85.3% | 83.2% | 1368_1488del;1538_1659del |
36 | human | 9628 | RGS6 | regulator of G protein sign... | NM_001370274.1 | 85.3% | 83.2% | 1368_1488del;1538_1659del |
37 | human | 9628 | RGS6 | regulator of G protein sign... | NM_001370279.1 | 84.8% | 82.6% | 679_680insAAAAGGTTA;1359_1479del;1529_1650del |
38 | human | 9628 | RGS6 | regulator of G protein sign... | NM_001370294.1 | 83.2% | 83.2% | 852_853ins237 |
39 | human | 9628 | RGS6 | regulator of G protein sign... | NM_001370278.1 | 81.2% | 79.2% | 1364_1568del;1622_1743del |
40 | human | 9628 | RGS6 | regulator of G protein sign... | NM_001370283.1 | 78.6% | 76.5% | 852_853ins111;1257_1377del;1427_1548del |
41 | human | 9628 | RGS6 | regulator of G protein sign... | XM_024449768.1 | 78.6% | 76.5% | 852_853ins111;1257_1377del;1427_1548del |
42 | human | 9628 | RGS6 | regulator of G protein sign... | XM_017021833.2 | 78.3% | 78.1% | (many diffs) |
43 | human | 9628 | RGS6 | regulator of G protein sign... | NM_001370277.1 | 76.8% | 75.9% | (many diffs) |
44 | human | 9628 | RGS6 | regulator of G protein sign... | NM_001370280.1 | 74% | 71.9% | 963_964ins126;1238_1442del;1496_1617del |
45 | human | 9628 | RGS6 | regulator of G protein sign... | NM_001370286.1 | 72.6% | 70.5% | (many diffs) |
46 | human | 9628 | RGS6 | regulator of G protein sign... | NM_001370275.1 | 71.9% | 70.1% | 1368_1488del;1538_1968del |
47 | human | 9628 | RGS6 | regulator of G protein sign... | NM_001370276.1 | 71.9% | 70.1% | 1368_1488del;1538_1968del |
48 | human | 9628 | RGS6 | regulator of G protein sign... | XM_024449759.1 | 69% | 67.2% | 1364_1568del;1622_2052del |
49 | human | 9628 | RGS6 | regulator of G protein sign... | XM_024449760.1 | 69% | 67.2% | 1364_1568del;1622_2052del |
50 | human | 9628 | RGS6 | regulator of G protein sign... | XM_024449761.1 | 69% | 67.2% | 1364_1568del;1622_2052del |
51 | human | 9628 | RGS6 | regulator of G protein sign... | XM_017021834.1 | 67.3% | 66.2% | (many diffs) |
52 | human | 9628 | RGS6 | regulator of G protein sign... | XM_017021820.2 | 63.5% | 61.8% | 852_853ins111;1253_1457del;1511_1941del |
53 | human | 9628 | RGS6 | regulator of G protein sign... | XM_024449763.1 | 58.9% | 57.2% | 0_1ins207;1157_1361del;1415_1845del |
54 | human | 9628 | RGS6 | regulator of G protein sign... | XM_024449764.1 | 58.9% | 57.2% | 0_1ins207;1157_1361del;1415_1845del |
55 | human | 9628 | RGS6 | regulator of G protein sign... | XM_011537393.2 | 50.2% | 47.8% | (many diffs) |
56 | human | 9628 | RGS6 | regulator of G protein sign... | XM_011537397.1 | 48.6% | 47% | 0_1ins417;947_1151del;1205_1635del |
57 | human | 9628 | RGS6 | regulator of G protein sign... | XM_011537407.2 | 37.7% | 36% | 0_1ins642;722_926del;980_1410del |
58 | human | 9628 | RGS6 | regulator of G protein sign... | NR_135235.2 | 24.8% | 1_101del;1469_1585del;1635_5700del | |
59 | human | 9628 | RGS6 | regulator of G protein sign... | XR_002957573.1 | 24% | 1_523del;1940_5876del | |
60 | human | 9628 | RGS6 | regulator of G protein sign... | XR_001750613.2 | 23.6% | 1_523del;1891_2007del;2057_5993del | |
61 | mouse | 50779 | Rgs6 | regulator of G-protein sign... | NM_001282061.2 | 92% | 97.6% | (many diffs) |
62 | mouse | 50779 | Rgs6 | regulator of G-protein sign... | NM_015812.4 | 92% | 97.6% | (many diffs) |
63 | mouse | 50779 | Rgs6 | regulator of G-protein sign... | NM_001310478.2 | 88.6% | 94% | (many diffs) |
64 | mouse | 50779 | Rgs6 | regulator of G-protein sign... | XM_011244133.2 | 78.6% | 81.3% | (many diffs) |
65 | mouse | 50779 | Rgs6 | regulator of G-protein sign... | XM_011244134.2 | 78.6% | 81.3% | (many diffs) |
66 | mouse | 50779 | Rgs6 | regulator of G-protein sign... | XM_011244135.2 | 78.6% | 81.3% | (many diffs) |
67 | mouse | 50779 | Rgs6 | regulator of G-protein sign... | XM_011244136.2 | 78.6% | 81.3% | (many diffs) |
68 | mouse | 50779 | Rgs6 | regulator of G-protein sign... | XM_011244137.2 | 78.6% | 81.3% | (many diffs) |
69 | mouse | 50779 | Rgs6 | regulator of G-protein sign... | XM_006516070.3 | 69.2% | 66.1% | (many diffs) |
70 | mouse | 50779 | Rgs6 | regulator of G-protein sign... | XM_011244138.2 | 67% | 69% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1485
- ORF length:
- 1416
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggctcaagga tccggggatc aaagagcagt gggggttgct gacccagagg 121 agagttctcc aaacatgatc gtttactgca aaattgaaga catcattaca aagatgcaag 181 atgacaagac agggggtgtg cccatcagaa cagtcaagag ctttctctcc aaaatcccca 241 gtgtcgtcac aggtactgac attgtgcagt ggcttatgaa gaacctttcc attgaggacc 301 cagttgaagc aatacacttg gggagcctta tcgctgccca gggctacatc tttccaatct 361 cagaccatgt tctcaccatg aaggatgatg gcacctttta tcgtttccag gctccgtact 421 tctggccttc gaactgctgg gaacctgaaa acactgacta tgccatctat ctctgtaaga 481 ggacaatgca aaataaagca aggctggaac tggcagatta tgaagcagaa aacttagcaa 541 gactccagag ggcctttgcg aggaagtggg aattcatctt tatgcaagca gaagcacaag 601 taaagattga ccggaaaaaa gacaagacag aaaggaaaat tttggatagt caagaacgag 661 ccttttggga tgtccacagg cctgtgccag gctgtgtgaa cacaacagaa atggatatcc 721 gaaaatgtcg acgtttgaag aatccacaaa aggttaaaaa gtccgtgtat ggcgtgactg 781 aagagtccca ggcacagagc ccggtgcatg tactcagcca accaatcagg aaaacaacaa 841 aagaggacat ccggaaacag ataacatttt tgaacgcaca gatcgacaga cattgtttga 901 aaatgtccaa agtggctgaa agtttaattg cctacacgga acaatatgtg gaatatgacc 961 ctttgataac accagctgag ccatccaacc cttggatcag cgatgacgtt gctttgtggg 1021 acatagagat gagcaaagag cccagccaac agcgagtaaa aagatggggc ttctctttcg 1081 atgagatatt gaaggaccag gtggggcggg accagtttct acgattcctg gagtccgaat 1141 tcagttcaga aaacctcagg ttctggctgg ctgtccaaga tcttaagaaa caaccccTAC 1201 AGGATGTGGC CAAGAGGGTA GAAGAAATCT GGCAAGAGTT TCTGGCTCCA GGGGCTCCAA 1261 GTGCAATCAA CCTGGATTCT CACAGCTATG AGATAACCAG TCAAAATGTC AAAGATGGAG 1321 GGAGATATAC ATTTGAAGAC GCCCAGGAGC ACATCTACAA GCTGATGAAG AGTGACAGCT 1381 ATGCCCGCTT CCTCCGGTCA AATGCTTACC AGGATTTGCT GCTGGCCAAG AAGAAGGGAA 1441 AGTCGCTGGC GGGCAAGCGC CTCACGGGCC TGATGCAGTC CTCCTTGCCA ACTTTCTTGT 1501 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 1561 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 1621 GAAAGGACGA ACGGACACCT GCAACTGCCC TCCGACGCGT TAAGTCgaca atcaacctct 1681 ggattacaaa atttgtgaaa gatt