Transcript: Mouse XM_011244542.2

PREDICTED: Mus musculus G kinase anchoring protein 1 (Gkap1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gkap1 (56278)
Length:
1596
CDS:
231..1331

Additional Resources:

NCBI RefSeq record:
XM_011244542.2
NBCI Gene record:
Gkap1 (56278)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011244542.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042796 CGCAGAAATTCAGAAGCTCAA pLKO.1 1028 CDS 100% 4.050 3.240 N Gkap1 n/a
2 TRCN0000354020 CGCAGAAATTCAGAAGCTCAA pLKO_005 1028 CDS 100% 4.050 3.240 N Gkap1 n/a
3 TRCN0000042797 GCTCAGACTTTATCACACGAT pLKO.1 828 CDS 100% 2.640 2.112 N Gkap1 n/a
4 TRCN0000326280 GCTCAGACTTTATCACACGAT pLKO_005 828 CDS 100% 2.640 2.112 N Gkap1 n/a
5 TRCN0000037740 GACTGGAAGATGATGTTCATA pLKO.1 865 CDS 100% 5.625 3.938 N GKAP1 n/a
6 TRCN0000042795 GCAACCTCAAATGAGAAGAAA pLKO.1 375 CDS 100% 5.625 3.938 N Gkap1 n/a
7 TRCN0000326279 GCAACCTCAAATGAGAAGAAA pLKO_005 375 CDS 100% 5.625 3.938 N Gkap1 n/a
8 TRCN0000042793 GCAATGTTCAACATGAGCTTT pLKO.1 499 CDS 100% 4.950 3.465 N Gkap1 n/a
9 TRCN0000326331 GCAATGTTCAACATGAGCTTT pLKO_005 499 CDS 100% 4.950 3.465 N Gkap1 n/a
10 TRCN0000042794 GCTGGAGTATGAAGAGCACAA pLKO.1 644 CDS 100% 4.050 2.835 N Gkap1 n/a
11 TRCN0000326281 GCTGGAGTATGAAGAGCACAA pLKO_005 644 CDS 100% 4.050 2.835 N Gkap1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011244542.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04206 pDONR223 100% 85.3% 87.9% None (many diffs) n/a
2 ccsbBroad304_04206 pLX_304 0% 85.3% 87.9% V5 (many diffs) n/a
3 TRCN0000470932 AAGGGCGCTTGCCAACTGACCGTC pLX_317 43.7% 85.3% 87.9% V5 (many diffs) n/a
4 TRCN0000487872 GGGACCAACACCTTACTTGGGCGC pLX_317 28.9% 85.3% 87.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV