Transcript: Mouse XM_011245133.2

PREDICTED: Mus musculus short chain dehydrogenase/reductase family 39U, member 1 (Sdr39u1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sdr39u1 (654795)
Length:
1585
CDS:
705..1265

Additional Resources:

NCBI RefSeq record:
XM_011245133.2
NBCI Gene record:
Sdr39u1 (654795)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011245133.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265756 CATCGGTTCAGGTCGCCAATT pLKO_005 929 CDS 100% 10.800 15.120 N Sdr39u1 n/a
2 TRCN0000256216 ACGTCCAAGGAGTCCTGAATG pLKO_005 1012 CDS 100% 10.800 8.640 N Sdr39u1 n/a
3 TRCN0000256215 TCTGCGAAGATGGAATGAAAC pLKO_005 490 5UTR 100% 10.800 7.560 N Sdr39u1 n/a
4 TRCN0000256214 AGAATCCATCAGGGTCTTAGA pLKO_005 1356 3UTR 100% 4.950 3.465 N Sdr39u1 n/a
5 TRCN0000256217 TACCAGCCAAGCCTGACTAAG pLKO_005 717 CDS 100% 0.000 0.000 N Sdr39u1 n/a
6 TRCN0000151673 GATGGAATGAAACCTTCCAAA pLKO.1 498 5UTR 100% 0.495 0.297 N SDR39U1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011245133.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08674 pDONR223 100% 55.5% 54.7% None (many diffs) n/a
2 ccsbBroad304_08674 pLX_304 0% 55.5% 54.7% V5 (many diffs) n/a
3 TRCN0000476499 ATAGAACACAATGGGTCCCTTACC pLX_317 35.1% 55.5% 54.7% V5 (many diffs) n/a
Download CSV