Transcript: Mouse XM_011245368.2

PREDICTED: Mus musculus serine/threonine kinase 3 (Stk3), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Stk3 (56274)
Length:
3023
CDS:
835..2034

Additional Resources:

NCBI RefSeq record:
XM_011245368.2
NBCI Gene record:
Stk3 (56274)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011245368.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000274761 TACATCCGATGAGGGCTATTT pLKO_005 1211 CDS 100% 13.200 18.480 N Stk3 n/a
2 TRCN0000374326 CTGCAAGAGAACTAATCTAAA pLKO_005 2269 3UTR 100% 13.200 10.560 N Stk3 n/a
3 TRCN0000025940 CCCATGATGGAACGAGAAATA pLKO.1 1927 CDS 100% 13.200 9.240 N Stk3 n/a
4 TRCN0000274759 CCCATGATGGAACGAGAAATA pLKO_005 1927 CDS 100% 13.200 9.240 N Stk3 n/a
5 TRCN0000025960 CCGGGAATATTCTCCTCAATA pLKO.1 986 CDS 100% 13.200 9.240 N Stk3 n/a
6 TRCN0000274762 CCGGGAATATTCTCCTCAATA pLKO_005 986 CDS 100% 13.200 9.240 N Stk3 n/a
7 TRCN0000274760 TGATGGTACACACCTAGATAA pLKO_005 2147 3UTR 100% 13.200 9.240 N Stk3 n/a
8 TRCN0000025880 CCTTCTTTCATGGACTACTTT pLKO.1 1729 CDS 100% 5.625 3.938 N Stk3 n/a
9 TRCN0000025947 GCAATTAAGCAAGTACCTGTT pLKO.1 505 5UTR 100% 4.050 2.835 N Stk3 n/a
10 TRCN0000025951 CCTGAGGTAATTCAAGAAATA pLKO.1 1108 CDS 100% 13.200 7.920 N Stk3 n/a
11 TRCN0000323443 CCTGAGGTAATTCAAGAAATA pLKO_005 1108 CDS 100% 13.200 7.920 N Stk3 n/a
12 TRCN0000002177 CGGATGAAGATGAGCTGGATT pLKO.1 1487 CDS 100% 4.950 2.970 N STK3 n/a
13 TRCN0000315193 CGGATGAAGATGAGCTGGATT pLKO_005 1487 CDS 100% 4.950 2.970 N STK3 n/a
14 TRCN0000087583 AGGAGGAAGAGGAAGAGGAAA pLKO.1 1655 CDS 100% 4.950 2.475 Y Adam32 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011245368.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07012 pDONR223 100% 70.5% 76.2% None (many diffs) n/a
2 ccsbBroad304_07012 pLX_304 20.5% 70.5% 76.2% V5 (many diffs) n/a
3 TRCN0000475289 ACCGACTTGTTGACGCTCCGTCAA pLX_317 20.2% 70.5% 76.2% V5 (many diffs) n/a
4 ccsbBroadEn_14850 pDONR223 0% 70.5% 76.2% None (many diffs) n/a
5 ccsbBroad304_14850 pLX_304 20.5% 70.5% 76.2% V5 (many diffs) n/a
6 TRCN0000470542 TGTCTGCAAGTCTCTCTATTTCCC pLX_317 26.5% 70.5% 76.2% V5 (many diffs) n/a
7 TRCN0000491248 TCAACTCTAATCTCTCTTATATGC pLX_317 13.9% 70.5% 76.2% V5 (not translated due to prior stop codon) (many diffs) n/a
8 TRCN0000488127 AACTCAATGCCCTACCTTGTAGCA pLX_317 20.6% 70.4% 76.1% V5 (many diffs) n/a
Download CSV