Transcript: Mouse XM_011245451.2

PREDICTED: Mus musculus plexin B2 (Plxnb2), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Plxnb2 (140570)
Length:
6650
CDS:
471..5999

Additional Resources:

NCBI RefSeq record:
XM_011245451.2
NBCI Gene record:
Plxnb2 (140570)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011245451.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078853 GCGTCTTTCTCCTGAGCAATA pLKO.1 6082 3UTR 100% 10.800 15.120 N Plxnb2 n/a
2 TRCN0000078857 CCAGGACATGAATACGCACTT pLKO.1 5783 CDS 100% 4.050 3.240 N Plxnb2 n/a
3 TRCN0000078856 CCAGTAGACATCAATAAGAAA pLKO.1 1773 CDS 100% 5.625 3.938 N Plxnb2 n/a
4 TRCN0000078854 CCCAGCAACAAGCTGTTGTAT pLKO.1 5685 CDS 100% 5.625 3.938 N Plxnb2 n/a
5 TRCN0000078855 CCTGCTTAATAGCAAGTCCTT pLKO.1 4445 CDS 100% 2.640 1.848 N Plxnb2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011245451.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15020 pDONR223 100% 22.7% 23.3% None (many diffs) n/a
2 ccsbBroad304_15020 pLX_304 0% 22.7% 23.3% V5 (many diffs) n/a
3 TRCN0000471923 GACCCGCTTCGCATAAACTTACGT pLX_317 23.5% 22.7% 23.3% V5 (many diffs) n/a
Download CSV