Transcript: Mouse XM_011245557.2

PREDICTED: Mus musculus thyrotroph embryonic factor (Tef), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tef (21685)
Length:
4546
CDS:
342..1364

Additional Resources:

NCBI RefSeq record:
XM_011245557.2
NBCI Gene record:
Tef (21685)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011245557.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000311031 ATCTACGTAGACGGGTAAATG pLKO_005 1580 3UTR 100% 13.200 18.480 N Tef n/a
2 TRCN0000086003 CCGCCGTATATGAGTTGTATT pLKO.1 2461 3UTR 100% 13.200 18.480 N Tef n/a
3 TRCN0000374330 CTCACGTCTCAGCTTCATTAT pLKO_005 1491 3UTR 100% 13.200 18.480 N Tef n/a
4 TRCN0000086007 CGTAAGAAGAACAATGTGGCA pLKO.1 1170 CDS 100% 0.660 0.528 N Tef n/a
5 TRCN0000331525 CGTAAGAAGAACAATGTGGCA pLKO_005 1170 CDS 100% 0.660 0.528 N Tef n/a
6 TRCN0000086005 GTATTGGACAAGACGTAAGAA pLKO.1 1157 CDS 100% 5.625 3.938 N Tef n/a
7 TRCN0000301986 GTATTGGACAAGACGTAAGAA pLKO_005 1157 CDS 100% 5.625 3.938 N Tef n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011245557.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07046 pDONR223 100% 79.4% 84.7% None (many diffs) n/a
2 ccsbBroad304_07046 pLX_304 0% 79.4% 84.7% V5 (many diffs) n/a
3 TRCN0000472817 CCTAAATAGATCCTATTGTTCCAC pLX_317 37.8% 79.4% 84.7% V5 (many diffs) n/a
Download CSV