Transcript: Mouse XM_011245813.2

PREDICTED: Mus musculus cell division cycle 45 (Cdc45), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cdc45 (12544)
Length:
2252
CDS:
428..2128

Additional Resources:

NCBI RefSeq record:
XM_011245813.2
NBCI Gene record:
Cdc45 (12544)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011245813.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000279336 CAGTTTGGGTTCAAGCATAAA pLKO_005 1517 CDS 100% 13.200 18.480 N Cdc45 n/a
2 TRCN0000279341 GCGTCATGTGTCCCGTCATAA pLKO_005 1165 CDS 100% 13.200 18.480 N Cdc45 n/a
3 TRCN0000173191 CCTCTCAGTAATTGAGCTGAA pLKO.1 2056 CDS 100% 4.050 5.670 N Cdc45 n/a
4 TRCN0000279261 CCTCTCAGTAATTGAGCTGAA pLKO_005 2056 CDS 100% 4.050 5.670 N Cdc45 n/a
5 TRCN0000193315 CAATGACACTCAGATCAAATT pLKO.1 757 CDS 100% 13.200 9.240 N Cdc45 n/a
6 TRCN0000279345 CAATGACACTCAGATCAAATT pLKO_005 757 CDS 100% 13.200 9.240 N Cdc45 n/a
7 TRCN0000193254 CAAGAACTTGAAACTGCATAT pLKO.1 593 CDS 100% 10.800 7.560 N Cdc45 n/a
8 TRCN0000176220 GCAAGAACTTGAAACTGCATA pLKO.1 592 CDS 100% 4.950 3.465 N Cdc45 n/a
9 TRCN0000175306 CTTTGTGTACTCGACAAAGAA pLKO.1 1855 CDS 100% 0.563 0.394 N Cdc45 n/a
10 TRCN0000279263 CTTTGTGTACTCGACAAAGAA pLKO_005 1855 CDS 100% 0.563 0.394 N Cdc45 n/a
11 TRCN0000145195 GCAAGAACTTGAAACTGCATT pLKO.1 592 CDS 100% 4.950 3.465 N CDC45 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011245813.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07220 pDONR223 100% 88.1% 91.6% None (many diffs) n/a
2 ccsbBroad304_07220 pLX_304 0% 88.1% 91.6% V5 (many diffs) n/a
3 TRCN0000477447 ATGAGCCGATCAGATTATCTGCCA pLX_317 17.6% 88.1% 91.6% V5 (many diffs) n/a
Download CSV