Transcript: Mouse XM_011245888.2

PREDICTED: Mus musculus zinc finger protein 148 (Zfp148), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp148 (22661)
Length:
3989
CDS:
286..2688

Additional Resources:

NCBI RefSeq record:
XM_011245888.2
NBCI Gene record:
Zfp148 (22661)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011245888.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000339447 TGCACTCAATGTCCCTATAAG pLKO_005 603 CDS 100% 13.200 18.480 N Zfp148 n/a
2 TRCN0000012951 GCATAGACGAAATGCAGTCTT pLKO.1 332 CDS 100% 4.950 6.930 N ZNF148 n/a
3 TRCN0000095935 GCTGGATCATTATTCCCACAA pLKO.1 1935 CDS 100% 4.050 5.670 N Zfp148 n/a
4 TRCN0000339378 CAGACTCTGCTGGATCATTAT pLKO_005 1927 CDS 100% 13.200 9.240 N Zfp148 n/a
5 TRCN0000351091 CTCTACTCGTCGAGCACTAAA pLKO_005 1345 CDS 100% 13.200 9.240 N Zfp148 n/a
6 TRCN0000095936 GCTGCCTTTAGAACGAACTAT pLKO.1 835 CDS 100% 5.625 3.938 N Zfp148 n/a
7 TRCN0000095938 GCTGGACAAATCTGACCTGAA pLKO.1 1299 CDS 100% 4.050 2.835 N Zfp148 n/a
8 TRCN0000012950 GCTTTCGATCAGGAATGAATT pLKO.1 2276 CDS 100% 0.000 0.000 N ZNF148 n/a
9 TRCN0000339449 CATTCTTAGGAGCGTAGTAAT pLKO_005 2997 3UTR 100% 13.200 7.920 N Zfp148 n/a
10 TRCN0000339379 TGAGACAACAGGATATGATAT pLKO_005 491 CDS 100% 13.200 7.920 N Zfp148 n/a
11 TRCN0000095937 CCCTTGGTGAATGTAAATGAT pLKO.1 2611 CDS 100% 5.625 3.375 N Zfp148 n/a
12 TRCN0000095934 CCTGGTTTAATTCTTCTCTTT pLKO.1 3741 3UTR 100% 4.950 2.970 N Zfp148 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011245888.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11236 pDONR223 100% 14.6% 13.5% None (many diffs) n/a
2 ccsbBroad304_11236 pLX_304 0% 14.6% 13.5% V5 (many diffs) n/a
3 TRCN0000481491 GACTCCGTCAACCTGCTACCACTA pLX_317 100% 14.6% 13.5% V5 (many diffs) n/a
Download CSV