Transcript: Mouse XM_011246098.2

PREDICTED: Mus musculus dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1a (Dyrk1a), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dyrk1a (13548)
Length:
5361
CDS:
291..2495

Additional Resources:

NCBI RefSeq record:
XM_011246098.2
NBCI Gene record:
Dyrk1a (13548)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001148321 TCAGCAACCTCTAACTAACC pXPR_003 AGG 115 5% 2 0.2853 Dyrk1a DYRK1A 76754
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011246098.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000321715 ACTCGGATTCAACCTTATTAT pLKO_005 1599 CDS 100% 15.000 21.000 N Dyrk1a n/a
2 TRCN0000023003 CGATGGCACTTGGAGCTTAAA pLKO.1 1400 CDS 100% 13.200 10.560 N Dyrk1a n/a
3 TRCN0000321713 CGATGGCACTTGGAGCTTAAA pLKO_005 1400 CDS 100% 13.200 10.560 N Dyrk1a n/a
4 TRCN0000022999 GCTGACTACTTGAAGTTCAAA pLKO.1 1542 CDS 100% 5.625 4.500 N Dyrk1a n/a
5 TRCN0000321650 ATGGAGCTATGGACGTTAATT pLKO_005 2287 CDS 100% 15.000 10.500 N Dyrk1a n/a
6 TRCN0000197202 GAATGGAGCTATGGACGTTAA pLKO.1 2285 CDS 100% 10.800 7.560 N DYRK1A n/a
7 TRCN0000321649 GTTACGATGATGATAACTATG pLKO_005 619 CDS 100% 10.800 7.560 N Dyrk1a n/a
8 TRCN0000023002 CGGAGTGCAATCAAGATTGTT pLKO.1 1101 CDS 100% 5.625 3.938 N Dyrk1a n/a
9 TRCN0000010615 GATTCAGCAACCTCTAACTAA pLKO.1 386 CDS 100% 5.625 3.938 N DYRK1A n/a
10 TRCN0000023001 CCTGCACATTACATGACTGAA pLKO.1 2385 CDS 100% 4.950 3.465 N Dyrk1a n/a
11 TRCN0000023000 CGGTATGAAATCGACTCCTTA pLKO.1 675 CDS 100% 4.950 3.465 N Dyrk1a n/a
12 TRCN0000000527 CTTTGGACAGAATGGAGCTAT pLKO.1 2276 CDS 100% 4.950 3.465 N DYRK1A n/a
13 TRCN0000000525 CAGTATATTCAGAGTCGCTTT pLKO.1 1161 CDS 100% 4.050 2.835 N DYRK1A n/a
14 TRCN0000010612 CAGTATATTCAGAGTCGCTTT pLKO.1 1161 CDS 100% 4.050 2.835 N DYRK1A n/a
15 TRCN0000000526 CGGAAGGTTTACAATGATGGT pLKO.1 600 CDS 100% 2.640 1.848 N DYRK1A n/a
16 TRCN0000010613 CGGAAGGTTTACAATGATGGT pLKO.1 600 CDS 100% 2.640 1.848 N DYRK1A n/a
17 TRCN0000273350 CGGAAGGTTTACAATGATGGT pLKO_005 600 CDS 100% 2.640 1.848 N DYRK1A n/a
18 TRCN0000321714 TTGGTCATTTGCCAACTAATT pLKO_005 2810 3UTR 100% 13.200 7.920 N Dyrk1a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011246098.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14621 pDONR223 66.3% 87.1% 28.6% None (many diffs) n/a
Download CSV