Transcript: Mouse XM_011246233.2

PREDICTED: Mus musculus serine/threonine kinase 38 (Stk38), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Stk38 (106504)
Length:
2910
CDS:
287..1531

Additional Resources:

NCBI RefSeq record:
XM_011246233.2
NBCI Gene record:
Stk38 (106504)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011246233.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000022864 GCCATACCTTCGTACATGAAA pLKO.1 1499 CDS 100% 5.625 7.875 N Stk38 n/a
2 TRCN0000292535 GCCATACCTTCGTACATGAAA pLKO_005 1499 CDS 100% 5.625 7.875 N Stk38 n/a
3 TRCN0000197233 GCAACCTTATCGCTCAACATG pLKO.1 125 5UTR 100% 4.950 6.930 N STK38 n/a
4 TRCN0000276642 AGACCAGCTGCGATATCTATT pLKO_005 1310 CDS 100% 13.200 9.240 N Stk38 n/a
5 TRCN0000361905 TGCCAAGCCCACCAAGTATTT pLKO_005 1914 3UTR 100% 13.200 9.240 N Stk38 n/a
6 TRCN0000195165 CAACATGAAGAACGAGAAATG pLKO.1 139 5UTR 100% 10.800 7.560 N STK38 n/a
7 TRCN0000285614 CAACATGAAGAACGAGAAATG pLKO_005 139 5UTR 100% 10.800 7.560 N Stk38 n/a
8 TRCN0000276705 CTCATCCATGAGTAATCATAC pLKO_005 57 5UTR 100% 10.800 7.560 N Stk38 n/a
9 TRCN0000022867 CGGAAGGAAACAGAGTTTCTT pLKO.1 344 CDS 100% 5.625 3.938 N Stk38 n/a
10 TRCN0000022865 GCTAAACCTCTACCTAATCAT pLKO.1 610 CDS 100% 5.625 3.938 N Stk38 n/a
11 TRCN0000276706 GCTAAACCTCTACCTAATCAT pLKO_005 610 CDS 100% 5.625 3.938 N Stk38 n/a
12 TRCN0000010214 CAGCAAGGGCCATGTGAAACT pLKO.1 796 CDS 100% 4.950 3.465 N STK38 n/a
13 TRCN0000280001 CAGCAAGGGCCATGTGAAACT pLKO_005 796 CDS 100% 4.950 3.465 N STK38 n/a
14 TRCN0000022868 CCCACAAGAGACATACAAGAA pLKO.1 1111 CDS 100% 4.950 3.465 N Stk38 n/a
15 TRCN0000022866 GATACCTCAAACTTCGATGAA pLKO.1 1349 CDS 100% 4.950 3.465 N Stk38 n/a
16 TRCN0000276704 TGTGATTGTAAGTGGATATTC pLKO_005 1661 3UTR 100% 13.200 7.920 N Stk38 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011246233.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02674 pDONR223 100% 82.2% 87.7% None (many diffs) n/a
2 ccsbBroad304_02674 pLX_304 0% 82.2% 87.7% V5 (many diffs) n/a
3 TRCN0000478960 AATTAGCCCCCACTGATCTCTTTG pLX_317 28% 82.2% 87.7% V5 (many diffs) n/a
4 ccsbBroadEn_14993 pDONR223 0% 82.2% 87.7% None (many diffs) n/a
5 ccsbBroad304_14993 pLX_304 0% 82.2% 87.7% V5 (many diffs) n/a
6 TRCN0000489616 GAGTGCTCGCGCCTTACTATGATC pLX_317 23.5% 82.2% 87.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV