Transcript: Mouse XM_011246335.2

PREDICTED: Mus musculus sine oculis-related homeobox 2 (Six2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Six2 (20472)
Length:
855
CDS:
102..734

Additional Resources:

NCBI RefSeq record:
XM_011246335.2
NBCI Gene record:
Six2 (20472)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011246335.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000070779 GCACTACATCGAGGCGGAGAA pLKO.1 371 CDS 100% 1.350 1.890 N Six2 n/a
2 TRCN0000070778 CCTCCACAAGAATGAAAGCGT pLKO.1 227 CDS 100% 0.750 0.525 N Six2 n/a
3 TRCN0000413841 CAACTTCCGCGAGCTCTACAA pLKO_005 284 CDS 100% 4.950 2.475 Y Six2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011246335.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07671 pDONR223 100% 64.6% 65% None (many diffs) n/a
2 ccsbBroad304_07671 pLX_304 0% 64.6% 65% V5 (many diffs) n/a
3 TRCN0000467949 TCAACACTCCCATCGGCATACTCT pLX_317 43.7% 64.6% 65% V5 (many diffs) n/a
4 ccsbBroadEn_06951 pDONR223 100% 61.4% 65.8% None (many diffs) n/a
5 ccsbBroad304_06951 pLX_304 0% 61.4% 65.8% V5 (many diffs) n/a
6 TRCN0000468669 TGGCTCCAGTACTTTTATCGAAGA pLX_317 6.1% 61.4% 65.8% V5 (many diffs) n/a
Download CSV