Transcript: Mouse XM_011247027.2

PREDICTED: Mus musculus membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7) (Mpp7), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mpp7 (75739)
Length:
4958
CDS:
299..2104

Additional Resources:

NCBI RefSeq record:
XM_011247027.2
NBCI Gene record:
Mpp7 (75739)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011247027.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000239240 GACAAGGCAATCCCGTGTAAA pLKO_005 1028 CDS 100% 13.200 18.480 N Mpp7 n/a
2 TRCN0000239242 TCGAAAGAAGGCAAGATATTT pLKO_005 974 CDS 100% 15.000 12.000 N Mpp7 n/a
3 TRCN0000220690 GCACAGATAATGGAAAGTCAA pLKO.1 1955 CDS 100% 4.950 3.960 N Mpp7 n/a
4 TRCN0000239241 CTCAGAGAAATGTCCTTAATT pLKO_005 2105 CDS 100% 15.000 10.500 N Mpp7 n/a
5 TRCN0000239243 TCATTGAGTATGGTGAATATA pLKO_005 1674 CDS 100% 15.000 10.500 N Mpp7 n/a
6 TRCN0000220691 CCTCATACAGTGAAGCATTTA pLKO.1 1775 CDS 100% 13.200 9.240 N Mpp7 n/a
7 TRCN0000239239 ACTATTATGGTACAAGTATAG pLKO_005 1701 CDS 100% 10.800 7.560 N Mpp7 n/a
8 TRCN0000220692 CTGTGGCATTTAATGAGCTAA pLKO.1 2019 CDS 100% 4.950 3.465 N Mpp7 n/a
9 TRCN0000220694 GCATTTAAGGACACTGGAGTT pLKO.1 1789 CDS 100% 4.050 2.835 N Mpp7 n/a
10 TRCN0000054408 ACGCCTTTAATCCCAGCACTT pLKO.1 3539 3UTR 100% 4.050 2.025 Y Mtif2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011247027.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09602 pDONR223 100% 84.4% 88.6% None (many diffs) n/a
2 ccsbBroad304_09602 pLX_304 0% 84.4% 88.6% V5 (many diffs) n/a
3 ccsbBroadEn_15255 pDONR223 87.3% 84.1% 36.7% None (many diffs) n/a
4 ccsbBroad304_15255 pLX_304 0% 84.1% 36.7% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000469992 TACTATCCTTGAGGTCGAGTTTCT pLX_317 23.6% 84.1% 36.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV