Transcript: Mouse XM_011247030.2

PREDICTED: Mus musculus trafficking protein particle complex 8 (Trappc8), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Trappc8 (75964)
Length:
5514
CDS:
319..4653

Additional Resources:

NCBI RefSeq record:
XM_011247030.2
NBCI Gene record:
Trappc8 (75964)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011247030.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000100912 CGACAGTTTATACAAGAGTTT pLKO.1 1363 CDS 100% 4.950 6.930 N Trappc8 n/a
2 TRCN0000100914 TGTGGCTAATAAAGGAGTAAT pLKO.1 2496 CDS 100% 13.200 9.240 N Trappc8 n/a
3 TRCN0000100913 GCAGTTGTAGAAGAGCCAATT pLKO.1 2584 CDS 100% 10.800 7.560 N Trappc8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011247030.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11640 pDONR223 100% 84.7% 87.6% None (many diffs) n/a
2 ccsbBroad304_11640 pLX_304 0% 84.7% 87.6% V5 (many diffs) n/a
3 TRCN0000469077 TTGCTATCCGGCCTCTAAAATGGG pLX_317 4.8% 84.7% 87.6% V5 (many diffs) n/a
4 ccsbBroadEn_11639 pDONR223 100% 41.5% 42.3% None (many diffs) n/a
5 ccsbBroad304_11639 pLX_304 0% 41.5% 42.3% V5 (many diffs) n/a
Download CSV