Transcript: Mouse XM_011247069.2

PREDICTED: Mus musculus RIKEN cDNA 8030462N17 gene (8030462N17Rik), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
8030462N17Rik (212163)
Length:
5054
CDS:
372..1403

Additional Resources:

NCBI RefSeq record:
XM_011247069.2
NBCI Gene record:
8030462N17Rik (212163)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011247069.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217606 GATGATGTTGTCTGGCGTAAT pLKO.1 2962 3UTR 100% 10.800 15.120 N 8030462N17Rik n/a
2 TRCN0000191327 CTGATTCAGATACATTGTCTT pLKO.1 682 CDS 100% 4.950 6.930 N 8030462N17Rik n/a
3 TRCN0000127876 GCCGAGTTTATGAGAGTGACT pLKO.1 616 CDS 100% 2.640 3.696 N C18orf25 n/a
4 TRCN0000201336 GAGAGTGACTCCTCTAATCAT pLKO.1 627 CDS 100% 5.625 4.500 N 8030462N17Rik n/a
5 TRCN0000191145 CCTCTAATCATTGCATGCTTT pLKO.1 637 CDS 100% 4.950 3.465 N 8030462N17Rik n/a
6 TRCN0000191117 GTTCTGAAAGTGAAACATCTA pLKO.1 802 CDS 100% 4.950 3.465 N 8030462N17Rik n/a
7 TRCN0000130621 CAGGACAGTAGTACCAGTGAT pLKO.1 975 CDS 100% 4.950 3.465 N C18orf25 n/a
8 TRCN0000330521 CAGGACAGTAGTACCAGTGAT pLKO_005 975 CDS 100% 4.950 3.465 N C18orf25 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011247069.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09644 pDONR223 100% 77.4% 80.6% None (many diffs) n/a
2 ccsbBroad304_09644 pLX_304 0% 77.4% 80.6% V5 (many diffs) n/a
3 TRCN0000480506 ACTTAACCGTCAGCACACAATTTC pLX_317 37.5% 77.4% 80.6% V5 (many diffs) n/a
Download CSV