Transcript: Mouse XM_011247155.2

PREDICTED: Mus musculus Janus kinase 2 (Jak2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Jak2 (16452)
Length:
7654
CDS:
3038..6436

Additional Resources:

NCBI RefSeq record:
XM_011247155.2
NBCI Gene record:
Jak2 (16452)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011247155.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000023652 CGTGGAATTTATGCGAATGAT pLKO.1 6211 CDS 100% 5.625 7.875 N Jak2 n/a
2 TRCN0000278125 CGTGGAATTTATGCGAATGAT pLKO_005 6211 CDS 100% 5.625 7.875 N Jak2 n/a
3 TRCN0000023651 CGGCCCAATATCAATGGATTT pLKO.1 4240 CDS 100% 10.800 8.640 N Jak2 n/a
4 TRCN0000278192 CGGCCCAATATCAATGGATTT pLKO_005 4240 CDS 100% 10.800 8.640 N Jak2 n/a
5 TRCN0000023653 CCAACATTACAGAGGCATAAT pLKO.1 4607 CDS 100% 13.200 9.240 N Jak2 n/a
6 TRCN0000278124 CCAACATTACAGAGGCATAAT pLKO_005 4607 CDS 100% 13.200 9.240 N Jak2 n/a
7 TRCN0000023649 CCTGGCAACAAGGAACATATT pLKO.1 5965 CDS 100% 13.200 9.240 N Jak2 n/a
8 TRCN0000278126 CCTGGCAACAAGGAACATATT pLKO_005 5965 CDS 100% 13.200 9.240 N Jak2 n/a
9 TRCN0000023650 CCGTGATCTTAACAGCCTGTT pLKO.1 5443 CDS 100% 4.050 2.430 N Jak2 n/a
10 TRCN0000278190 CCGTGATCTTAACAGCCTGTT pLKO_005 5443 CDS 100% 4.050 2.430 N Jak2 n/a
11 TRCN0000003179 CACAGTTTGAAGAGAGACATT pLKO.1 5562 CDS 100% 4.950 3.465 N JAK2 n/a
12 TRCN0000350495 CACAGTTTGAAGAGAGACATT pLKO_005 5562 CDS 100% 4.950 3.465 N JAK2 n/a
13 TRCN0000177808 CCTGGAACTTGCTATGTAGAT pLKO.1 2931 5UTR 100% 4.950 2.475 Y 2310022A10Rik n/a
14 TRCN0000286002 CCTGGAACTTGCTATGTAGAT pLKO_005 2931 5UTR 100% 4.950 2.475 Y 2310022A10Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011247155.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14680 pDONR223 0% 88.6% 93.7% None (many diffs) n/a
2 TRCN0000472785 CCCCCACGAGTCAAACATTTAGTC pLX_317 12.6% 88.5% 93.7% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroad304_14680 pLX_304 14.6% 85.9% 81.1% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000488199 AACGTGGACCCGTCCGTGGCAGGT pLX_317 8.7% 88.5% 93.7% V5 (not translated due to prior stop codon) (many diffs) n/a
5 ccsbBroadEn_10929 pDONR223 100% 88.4% 93.5% None (many diffs) n/a
6 ccsbBroad304_10929 pLX_304 0% 88.4% 93.5% V5 (many diffs) n/a
Download CSV