Transcript: Mouse XM_011247385.2

PREDICTED: Mus musculus RAB3A interacting protein (rabin3)-like 1 (Rab3il1), transcript variant X8, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rab3il1 (74760)
Length:
2637
CDS:
624..1715

Additional Resources:

NCBI RefSeq record:
XM_011247385.2
NBCI Gene record:
Rab3il1 (74760)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011247385.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000110148 CTTCTTCACCTATATTCGCTA pLKO.1 1583 CDS 100% 2.640 3.696 N Rab3il1 n/a
2 TRCN0000110146 GCCCACTGTTGAGTGTAACAA pLKO.1 1439 CDS 100% 5.625 4.500 N Rab3il1 n/a
3 TRCN0000140658 CCTGTTTGAGGAAGCTCACAA pLKO.1 770 CDS 100% 4.950 3.465 N RAB3IL1 n/a
4 TRCN0000110149 GAGCTGAAGCTAAAGGATGAA pLKO.1 684 CDS 100% 4.950 3.465 N Rab3il1 n/a
5 TRCN0000110147 GTATGCAACTTCTTCACCTAT pLKO.1 1575 CDS 100% 4.950 3.465 N Rab3il1 n/a
6 TRCN0000140631 GAGGAAGCTCACAAGATGGTT pLKO.1 777 CDS 100% 3.000 1.500 Y RAB3IL1 n/a
7 TRCN0000140875 GTTCTGGGAGATCATGAGGTT pLKO.1 1643 CDS 100% 2.640 1.848 N RAB3IL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011247385.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01359 pDONR223 100% 63.4% 66.1% None (many diffs) n/a
2 ccsbBroad304_01359 pLX_304 0% 63.4% 66.1% V5 (many diffs) n/a
3 TRCN0000475494 CCCCTAGTCAGCCACCACAGAATC pLX_317 43.6% 63.3% 37.2% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_15558 pDONR223 0% 43.7% 45.8% None (many diffs) n/a
5 ccsbBroad304_15558 pLX_304 0% 43.7% 45.8% V5 (many diffs) n/a
Download CSV