Construct: ORF TRCN0000475494
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009983.1_s317c1
- Derived from:
- ccsbBroadEn_01359
- DNA Barcode:
- CCCCTAGTCAGCCACCACAGAATC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- RAB3IL1 (5866)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475494
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5866 | RAB3IL1 | RAB3A interacting protein l... | NM_013401.4 | 99.8% | 64.6% | 477G>A;700_701insC |
| 2 | human | 5866 | RAB3IL1 | RAB3A interacting protein l... | XM_005274140.5 | 88.6% | 56.8% | (many diffs) |
| 3 | human | 5866 | RAB3IL1 | RAB3A interacting protein l... | XM_006718647.4 | 88.4% | 57% | (many diffs) |
| 4 | human | 5866 | RAB3IL1 | RAB3A interacting protein l... | XM_011545198.2 | 84.1% | 56.1% | (many diffs) |
| 5 | human | 5866 | RAB3IL1 | RAB3A interacting protein l... | XM_011545197.2 | 82.9% | 54.4% | (many diffs) |
| 6 | human | 5866 | RAB3IL1 | RAB3A interacting protein l... | XM_011545196.2 | 75.9% | 50.1% | (many diffs) |
| 7 | human | 5866 | RAB3IL1 | RAB3A interacting protein l... | NM_001271686.2 | 71.7% | 39.8% | (many diffs) |
| 8 | human | 5866 | RAB3IL1 | RAB3A interacting protein l... | XM_011545199.2 | 61% | 35.1% | (many diffs) |
| 9 | human | 5866 | RAB3IL1 | RAB3A interacting protein l... | XM_011545200.2 | 50.7% | 22.5% | (many diffs) |
| 10 | human | 5866 | RAB3IL1 | RAB3A interacting protein l... | XM_011545201.3 | 40% | 43.3% | (many diffs) |
| 11 | mouse | 74760 | Rab3il1 | RAB3A interacting protein (... | NM_144538.2 | 84.6% | 53.2% | (many diffs) |
| 12 | mouse | 74760 | Rab3il1 | RAB3A interacting protein (... | XM_006527411.3 | 75.1% | 47.2% | (many diffs) |
| 13 | mouse | 74760 | Rab3il1 | RAB3A interacting protein (... | NM_001347429.1 | 71.5% | 41.9% | (many diffs) |
| 14 | mouse | 74760 | Rab3il1 | RAB3A interacting protein (... | XM_011247385.2 | 63.3% | 37.2% | (many diffs) |
| 15 | mouse | 74760 | Rab3il1 | RAB3A interacting protein (... | XM_017318302.1 | 54.6% | 24.8% | (many diffs) |
| 16 | mouse | 74760 | Rab3il1 | RAB3A interacting protein (... | XR_877693.2 | 44.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 900
- ORF length:
- 834
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtg gagcggccca ccccagccag accagggcct cccgccgccc cttgcagctg 121 tcccggtccc ctggaagagc acggacccct gccaaggcca cagggagtcc ccaggagccc 181 tggtggagac ctctgcaggg gaggaggccc aaggccagga gggccccgca gccgcccagc 241 tggacgtgtt gcgcctgcgc agctcttcca tggagatccg agagaagggc tccgagttcc 301 tgaaggagga gctgcacaga gcgcagaagg agctgaagct aaaggacgag gaatgtgagc 361 ggctgtccaa ggtgcgggag cagctagaac aggagctgga agagctgacg gccagcctgt 421 ttgaggaagc tcacaagatg gttcgagaag ccaacatgaa gcaggcggca tcagaaaagc 481 agctgaagga ggctcggggc aagatcgaca tgctgcaggc agaggtgaca gccttgaaga 541 cactggtcat cacgtccaca ccagcctctc ccaaccgcga gcttcacccc cagctgctga 601 gccccaccaa ggccgggccc cgaaagggcc actctcgcca caagagcacc agcagcaccc 661 tctgccccgc cgtgtgtccc gctgcgggac acaccctcac cccagacaga gaggGCAAGG 721 AGGTGGACAC AATCCTGTTT GCAGAGTTCC AGGCCTGGAG GGAATCCCCC CACCCTGGAC 781 AAGACCTGCC CCTTCCTGGA AAGGGTGTAC CGAGAGGACG TGGGCCCCTG CCTGGACTTC 841 ACAATGCAGG AGCTCTCGGT GCTGGTACGG GCCGCCGTGG AGGACAACAC GCTCACCATT 901 GAGCCGGTGG CTTCGCAGAC GCTGCCCACA GTGAAGGTGG CCGAGGTTGA CTGTAGCAGC 961 ACCAACACAT GTGCCCTGAG CGGGCTGACC CGCACCTGCC GCCACCGAAT CCGGCTCGGG 1021 GACTCCAAAA GCCATTACTA CATCTCGCCA TCTTCCCGGG CCAGGATCAC CGCAGTGTGC 1081 AACTTCTTCA CCTACATCCG CTACATCCAG CAAGGCCTGG TGCGGCAGGA CGCAGAGCCC 1141 ATGTTCTGGG AGATCATGAG GTTGCGGAAG GAGATGTCAC TGGCCAAGCT CGGCTTCTTC 1201 CCCCAGGAGG CTTACCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT 1261 AACCCTCTCC TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT 1321 TCGATTTCTT GGCTTTATAT ATCTTGTGGA AAGGACGACC CCTAGTCAGC CACCACAGAA 1381 TCACGCGTTA AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt