Transcript: Mouse XM_011248836.2

PREDICTED: Mus musculus sarcoglycan, alpha (dystrophin-associated glycoprotein) (Sgca), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sgca (20391)
Length:
1393
CDS:
41..1204

Additional Resources:

NCBI RefSeq record:
XM_011248836.2
NBCI Gene record:
Sgca (20391)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011248836.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250994 ACACAGCGCAGTCCCTATAAC pLKO_005 275 CDS 100% 13.200 10.560 N Sgca n/a
2 TRCN0000265292 CTGTCCTGCTACGACACTTTG pLKO_005 728 CDS 100% 10.800 7.560 N Sgca n/a
3 TRCN0000250995 CTGTTCCATCCATGGGAATAC pLKO_005 1042 CDS 100% 10.800 7.560 N Sgca n/a
4 TRCN0000258149 TCGAGGTCACAGCCTACAATC pLKO_005 348 CDS 100% 10.800 7.560 N Sgca n/a
5 TRCN0000194637 GTTGCCATACCAAGCTGAGTT pLKO.1 433 CDS 100% 4.950 3.465 N Sgca n/a
6 TRCN0000193466 GTATACATTAAGGTAGGCTCT pLKO.1 626 CDS 100% 2.160 1.512 N Sgca n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011248836.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01526 pDONR223 100% 84.1% 88.8% None (many diffs) n/a
2 ccsbBroad304_01526 pLX_304 0% 84.1% 88.8% V5 (many diffs) n/a
3 TRCN0000478786 TCTGTTATTACTGCCATCTCCATC pLX_317 31% 84.1% 88.8% V5 (many diffs) n/a
Download CSV