Transcript: Mouse XM_011248927.2

PREDICTED: Mus musculus DEAH (Asp-Glu-Ala-His) box polypeptide 33 (Dhx33), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dhx33 (216877)
Length:
4547
CDS:
11..1522

Additional Resources:

NCBI RefSeq record:
XM_011248927.2
NBCI Gene record:
Dhx33 (216877)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011248927.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051461 GCTATCGCAAAGTGATCATTT pLKO.1 435 CDS 100% 13.200 18.480 N DHX33 n/a
2 TRCN0000310442 GCTATCGCAAAGTGATCATTT pLKO_005 435 CDS 100% 13.200 18.480 N DHX33 n/a
3 TRCN0000303661 GTTGACACGGGCATGGTTAAA pLKO_005 506 CDS 100% 13.200 18.480 N DHX33 n/a
4 TRCN0000051458 GCTCAATATCTATCGGACCTT pLKO.1 1084 CDS 100% 2.640 3.696 N DHX33 n/a
5 TRCN0000113059 CCTCTTTATGAATACTGCTGA pLKO.1 1279 CDS 100% 2.640 2.112 N Dhx33 n/a
6 TRCN0000113055 CGTGACTACTTGGATAGAAAT pLKO.1 3330 3UTR 100% 13.200 9.240 N Dhx33 n/a
7 TRCN0000113058 CTAGCAATGAAAGTCCCAAAT pLKO.1 737 CDS 100% 10.800 7.560 N Dhx33 n/a
8 TRCN0000113056 CCTAGCAATGAAAGTCCCAAA pLKO.1 736 CDS 100% 4.050 2.835 N Dhx33 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011248927.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12312 pDONR223 100% 86.7% 89.6% None (many diffs) n/a
2 ccsbBroad304_12312 pLX_304 0% 86.7% 89.6% V5 (many diffs) n/a
3 TRCN0000471365 TTAATTAGCCCCATTGTGCGTCGG pLX_317 33.3% 86.7% 89.6% V5 (many diffs) n/a
Download CSV