Transcript: Mouse XM_011249154.2

PREDICTED: Mus musculus DnaJ heat shock protein family (Hsp40) member C7 (Dnajc7), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dnajc7 (56354)
Length:
1853
CDS:
136..1572

Additional Resources:

NCBI RefSeq record:
XM_011249154.2
NBCI Gene record:
Dnajc7 (56354)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011249154.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000009545 GCCGTCATGGAGTATGAGAAA pLKO.1 508 CDS 100% 4.950 6.930 N Dnajc7 n/a
2 TRCN0000278113 GCCGTCATGGAGTATGAGAAA pLKO_005 508 CDS 100% 4.950 6.930 N Dnajc7 n/a
3 TRCN0000009547 GCTAAGAAGGACTACAACGAA pLKO.1 205 CDS 100% 3.000 2.400 N Dnajc7 n/a
4 TRCN0000278177 GCTAAGAAGGACTACAACGAA pLKO_005 205 CDS 100% 3.000 2.400 N Dnajc7 n/a
5 TRCN0000009546 GCCATAGAAGACTGTACAAAT pLKO.1 1024 CDS 100% 13.200 9.240 N Dnajc7 n/a
6 TRCN0000278180 GCCATAGAAGACTGTACAAAT pLKO_005 1024 CDS 100% 13.200 9.240 N Dnajc7 n/a
7 TRCN0000008770 GCCCTAGAACTGGATCATAAA pLKO.1 451 CDS 100% 13.200 9.240 N DNAJC7 n/a
8 TRCN0000009544 CCTGTGTACTTAGAGCAGTTT pLKO.1 1658 3UTR 100% 4.950 3.465 N Dnajc7 n/a
9 TRCN0000278178 CCTGTGTACTTAGAGCAGTTT pLKO_005 1658 3UTR 100% 4.950 3.465 N Dnajc7 n/a
10 TRCN0000009548 GAGGAGAAGAAGTTTAAGGAA pLKO.1 1357 CDS 100% 3.000 2.100 N Dnajc7 n/a
11 TRCN0000278112 GAGGAGAAGAAGTTTAAGGAA pLKO_005 1357 CDS 100% 3.000 2.100 N Dnajc7 n/a
12 TRCN0000423213 ATGGACCGTGCCCTAGAATTT pLKO_005 580 CDS 100% 13.200 7.920 N DNAJC7 n/a
13 TRCN0000008773 GCCATAGATATGTGTCCTAAA pLKO.1 247 CDS 100% 10.800 15.120 N DNAJC7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011249154.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11207 pDONR223 100% 88.9% 93.8% None (many diffs) n/a
2 ccsbBroad304_11207 pLX_304 0% 88.9% 93.8% V5 (many diffs) n/a
3 TRCN0000481213 GTGGCGCCAAGTCGCAATGGACTC pLX_317 26.7% 88.9% 93.8% V5 (many diffs) n/a
4 ccsbBroadEn_01721 pDONR223 100% 88.1% 91.9% None (many diffs) n/a
5 ccsbBroad304_01721 pLX_304 0% 88.1% 91.9% V5 (many diffs) n/a
6 TRCN0000471812 ATCGGGCTTACCTGACCAAAAATA pLX_317 23.1% 88.1% 91.9% V5 (many diffs) n/a
7 ccsbBroadEn_01722 pDONR223 100% 84.3% 89.7% None (many diffs) n/a
8 ccsbBroad304_01722 pLX_304 0% 84.3% 89.7% V5 (many diffs) n/a
9 TRCN0000471457 GGCTCTGTTACACGCCGCCTATAT pLX_317 32.1% 84.3% 89.7% V5 (many diffs) n/a
Download CSV