Transcript: Mouse XM_011249723.2

PREDICTED: Mus musculus transducin (beta)-like 1X-linked receptor 1 (Tbl1xr1), transcript variant X8, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tbl1xr1 (81004)
Length:
8084
CDS:
634..1917

Additional Resources:

NCBI RefSeq record:
XM_011249723.2
NBCI Gene record:
Tbl1xr1 (81004)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011249723.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000109343 CGTAGATAAGACCACCATCAT pLKO.1 1227 CDS 100% 4.950 3.960 N Tbl1xr1 n/a
2 TRCN0000109344 GCACATACCATCGCAAATAAT pLKO.1 784 CDS 100% 15.000 10.500 N Tbl1xr1 n/a
3 TRCN0000317947 GCACATACCATCGCAAATAAT pLKO_005 784 CDS 100% 15.000 10.500 N Tbl1xr1 n/a
4 TRCN0000109342 GCATCCTTTGATTCTACAGTT pLKO.1 1624 CDS 100% 4.950 3.465 N Tbl1xr1 n/a
5 TRCN0000318015 GCATCCTTTGATTCTACAGTT pLKO_005 1624 CDS 100% 4.950 3.465 N Tbl1xr1 n/a
6 TRCN0000109340 GCATGAAGTAAGGGAGTGAAT pLKO.1 2406 3UTR 100% 4.950 3.465 N Tbl1xr1 n/a
7 TRCN0000317949 GCATGAAGTAAGGGAGTGAAT pLKO_005 2406 3UTR 100% 4.950 3.465 N Tbl1xr1 n/a
8 TRCN0000109341 CCTTTGGTATAGAGAGCCATA pLKO.1 452 5UTR 100% 4.050 2.835 N Tbl1xr1 n/a
9 TRCN0000317946 CCTTTGGTATAGAGAGCCATA pLKO_005 452 5UTR 100% 4.050 2.835 N Tbl1xr1 n/a
10 TRCN0000182392 GCTGTCCTCGAACTCAGAAAT pLKO.1 3503 3UTR 100% 13.200 6.600 Y Cracr2b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011249723.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08951 pDONR223 100% 75.8% 81.9% None (many diffs) n/a
2 ccsbBroad304_08951 pLX_304 43.1% 75.8% 81.9% V5 (many diffs) n/a
3 TRCN0000480332 GGCCGACAAGGCAACTCACGGAAA pLX_317 29.2% 75.8% 81.9% V5 (many diffs) n/a
Download CSV