Transcript: Mouse XM_011249798.2

PREDICTED: Mus musculus family with sequence similarity 126, member A (Fam126a), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fam126a (84652)
Length:
6106
CDS:
688..2253

Additional Resources:

NCBI RefSeq record:
XM_011249798.2
NBCI Gene record:
Fam126a (84652)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011249798.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264952 ACGTCCTCAGTGAGGTTATTT pLKO_005 2508 3UTR 100% 15.000 21.000 N Fam126a n/a
2 TRCN0000201316 GCCACCATATTGAAACCTCAT pLKO.1 4012 3UTR 100% 4.050 5.670 N Fam126a n/a
3 TRCN0000264948 AGTTGACAAACACGGACATAG pLKO_005 1026 CDS 100% 10.800 8.640 N Fam126a n/a
4 TRCN0000190725 GCTGTGTTACAATGCTGCCTT pLKO.1 1242 CDS 100% 2.640 2.112 N Fam126a n/a
5 TRCN0000264951 AGCAGGGACCTCCTAGTATTA pLKO_005 2210 CDS 100% 13.200 9.240 N Fam126a n/a
6 TRCN0000264949 GCGGCCACTGTATTTAGTAAA pLKO_005 2023 CDS 100% 13.200 9.240 N Fam126a n/a
7 TRCN0000217676 GGAGCAGATGCCAATAGATTT pLKO.1 2110 CDS 100% 13.200 9.240 N Fam126a n/a
8 TRCN0000264950 GGAGCAGATGCCAATAGATTT pLKO_005 2110 CDS 100% 13.200 9.240 N Fam126a n/a
9 TRCN0000190621 GCCTGTAGTCTCCAAGAAGAA pLKO.1 2134 CDS 100% 4.950 3.465 N Fam126a n/a
10 TRCN0000128334 GTTACAATGCTGCCTTAACTT pLKO.1 1247 CDS 100% 5.625 3.938 N FAM126A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011249798.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04411 pDONR223 100% 88.4% 91.7% None (many diffs) n/a
2 ccsbBroad304_04411 pLX_304 0% 88.4% 91.7% V5 (many diffs) n/a
3 TRCN0000479538 CCGTAGCTAACTGCAGGACGGTTG pLX_317 17.5% 88.4% 91.7% V5 (many diffs) n/a
Download CSV