Transcript: Mouse XM_011249939.2

PREDICTED: Mus musculus LYN proto-oncogene, Src family tyrosine kinase (Lyn), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lyn (17096)
Length:
2799
CDS:
159..1430

Additional Resources:

NCBI RefSeq record:
XM_011249939.2
NBCI Gene record:
Lyn (17096)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011249939.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000023664 CGCGAGAGTCATCGAAGATAA pLKO.1 1055 CDS 100% 13.200 18.480 N Lyn n/a
2 TRCN0000345118 CGCGAGAGTCATCGAAGATAA pLKO_005 1055 CDS 100% 13.200 18.480 N Lyn n/a
3 TRCN0000023668 GAGTCACTCATGTGCAAGATT pLKO.1 1020 CDS 100% 5.625 3.938 N Lyn n/a
4 TRCN0000345168 GAGTCACTCATGTGCAAGATT pLKO_005 1020 CDS 100% 5.625 3.938 N Lyn n/a
5 TRCN0000023666 GCCAAGGTCAACACCTTAGAA pLKO.1 246 CDS 100% 0.563 0.338 N Lyn n/a
6 TRCN0000345167 GCCAAGGTCAACACCTTAGAA pLKO_005 246 CDS 100% 0.563 0.338 N Lyn n/a
7 TRCN0000023665 GTGGCCTTATACCCTTATGAT pLKO.1 96 5UTR 100% 5.625 2.813 Y Lyn n/a
8 TRCN0000023667 GACATGATTAAGCATTACCAA pLKO.1 507 CDS 100% 3.000 1.500 Y Lyn n/a
9 TRCN0000353110 GACATGATTAAGCATTACCAA pLKO_005 507 CDS 100% 3.000 1.500 Y Lyn n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011249939.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06546 pDONR223 100% 73.1% 80.2% None (many diffs) n/a
2 ccsbBroad304_06546 pLX_304 35.5% 73.1% 80.2% V5 (many diffs) n/a
3 TRCN0000469344 CTACGAAATGCTTCACGGTCCCTA pLX_317 21.7% 73.1% 80.2% V5 (many diffs) n/a
4 ccsbBroadEn_00954 pDONR223 100% 73.1% 80.2% None (many diffs) n/a
5 ccsbBroad304_00954 pLX_304 28.5% 73.1% 80.2% V5 (many diffs) n/a
6 TRCN0000466140 TAAATGCTCCGCACTTCGTAATCC pLX_317 24.9% 73.1% 80.2% V5 (many diffs) n/a
7 ccsbBroad304_14691 pLX_304 35.4% 73.1% 80.2% V5 (many diffs) n/a
8 TRCN0000471646 GTCCTACCCTCCAATGTTAAGAAC pLX_317 26.9% 73.1% 80.2% V5 (many diffs) n/a
9 ccsbBroadEn_14691 pDONR223 0% 73.1% 80.2% None (many diffs) n/a
10 TRCN0000489438 TACAAGTCCACCTCAGCGCGCCTC pLX_317 25% 73% 80.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV