Transcript: Mouse XM_011249943.2

PREDICTED: Mus musculus neutral sphingomyelinase (N-SMase) activation associated factor (Nsmaf), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nsmaf (18201)
Length:
3773
CDS:
631..3099

Additional Resources:

NCBI RefSeq record:
XM_011249943.2
NBCI Gene record:
Nsmaf (18201)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011249943.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428157 CAACATTGTGGCACCGTATAA pLKO_005 1071 CDS 100% 13.200 18.480 N Nsmaf n/a
2 TRCN0000111691 GCTCCTTAAAGATATGTTCAA pLKO.1 878 CDS 100% 4.950 6.930 N Nsmaf n/a
3 TRCN0000140313 CGAAACCTGTGGTCCAGATAA pLKO.1 1403 CDS 100% 13.200 10.560 N NSMAF n/a
4 TRCN0000437094 TGCAACCTTCCGAGATCTTAG pLKO_005 1776 CDS 100% 10.800 7.560 N Nsmaf n/a
5 TRCN0000111694 GCACCTTTCCAACTACCAGTA pLKO.1 1641 CDS 100% 4.050 2.835 N Nsmaf n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011249943.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07239 pDONR223 100% 71.4% 75% None (many diffs) n/a
2 ccsbBroad304_07239 pLX_304 0% 71.4% 75% V5 (many diffs) n/a
3 TRCN0000475792 AGCCTGACAGCACTTAAATTCTAA pLX_317 10.8% 71.4% 75% V5 (many diffs) n/a
Download CSV