Transcript: Human XM_011509124.2

PREDICTED: Homo sapiens solute carrier family 26 member 9 (SLC26A9), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC26A9 (115019)
Length:
1635
CDS:
127..1527

Additional Resources:

NCBI RefSeq record:
XM_011509124.2
NBCI Gene record:
SLC26A9 (115019)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011509124.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044052 GATCCTGATTTCGGTGCTCAA pLKO.1 768 CDS 100% 4.050 3.240 N SLC26A9 n/a
2 TRCN0000291285 GATCCTGATTTCGGTGCTCAA pLKO_005 768 CDS 100% 4.050 3.240 N SLC26A9 n/a
3 TRCN0000296821 TCTTTACCTTCATTGACATTT pLKO_005 839 CDS 100% 13.200 9.240 N SLC26A9 n/a
4 TRCN0000044048 GCTCGCTACATGCACAAGATT pLKO.1 946 CDS 100% 5.625 3.938 N SLC26A9 n/a
5 TRCN0000044051 GTGGGAGAGAAACTTCGCAAT pLKO.1 223 CDS 100% 4.050 2.835 N SLC26A9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011509124.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09411 pDONR223 100% 58.7% 58.4% None (many diffs) n/a
2 ccsbBroad304_09411 pLX_304 0% 58.7% 58.4% V5 (many diffs) n/a
3 TRCN0000476089 GGCGACATTGCGCTGAAATTTATA pLX_317 13.2% 58.7% 58.4% V5 (many diffs) n/a
Download CSV